Dmtn (NM_013514) Mouse Untagged Clone

CAT#: MC208441

Dmtn (untagged) - Mouse erythrocyte protein band 4.9 (Epb4.9), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dmtn
• Synonyms: AI325486; dematin; Epb4.9; Epb49
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208441 representing NM_013514
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAACGTCTGCAGAAGCAACCTCTTACCTCCCCGGGGAGCGTCAGCTCCTCCAGAGACTCCAGTGTGC
  CCGGCTCTCCCTCCAGCATCGTGGCCAAGATGGACAACCAGGTGTTGGGCTACAAGGATCTGGCTGCCAT
  CCCCAAGGACAAGGCCATCCTGGACATTGAGCGACCTGACCTCATGATCTATGAGCCCCACTTTACCTAT
  TCCCTCCTGGAACATGTAGAGCTGCCCAGAAGCCGGGAGTGCTCACTGTCACCCAAATCCACATCCCCCC
  CACCGTCTCCAGAGGTGTGGGCGGAGAGCCGGACTCTTGGAATCATCTCTCAGGCTTCAACCCCAAGGAC
  CACAGGGACCCCCAGGACCAGCCTGCCCCACTTCCACCACCCTGAGACTACCCGCCCGGATTCCAACATC
  TACAAGAAGCCACCCATCTACAAACAGAGAGAATCCGTGGGAGGCAGCCCTCAGAGCAAGCACCTCATCG
  AGGACCTCATCATCGAATCCTCCAAGTTTCCTGCAGCGCAGCCCCCTGACCCCAACCAGCCAGCCAAGAT
  AGAGACTGACTACTGGCCATGTCCCCCGTCGCTGGCCGTTGTGGAGACAGAATGGAGGAAACGGAAGGCA
  TCTCGAAAGGGGGCAGAGGAAGAGGAGGAAGAGGAAGACGATGACTCTGAAGAGGAGATTAAGGCCATCA
  GGGAACGGCAGAAAGAGGAGCTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTGAAAGAAGAGAT
  GGAAAAGTCATTGCCCATCCGGAGGAAAACACGCTCTCTGCCTGACCGGACACCCTTCCATACCTCCTTG
  CATTCGGGAACATCTAAATCCTCTTCGCTTCCTTCCTATGGCAGGACCACCCTGAGCCGGCTACAGTCCA
  CAGAATTCAGCCCATCGGGAAGTGAGGCTGGGAGCCCAGGCCTGCAGATCTATCCCTATGAGATGCTGGT
  GGTGACCAATAAGGGGAGAACTAAGCTGCCTCCGGGTGTGGACCGCATGAGGCTTGAGAGGCATTTGTCA
  GCAGAGGACTTCTCTAGGGTCTTCGCCATGTCTCCCGAGGAGTTTGGCAAGCTGGCCCTGTGGAAGCGGA
  ACGAACTTAAGAAGAAAGCTTCCCTCTTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013514
• Insert Size: 1152 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_013514.4, NP_038542.1
• RefSeq Size: 4129 bp
• RefSeq ORF: 1152 bp
• Locus ID: 13829
• UniProt ID: Q9WV69
• Cytogenetics: 14 36.32 cM
• Gene Summary: Membrane-cytoskeleton-associated protein with F-actin-binding activity that induces F-actin bundles formation and stabilization. Its F-actin-bundling activity is reversibly regulated upon its phosphorylation by the cAMP-dependent protein kinase A (PKA). Binds to the erythrocyte membrane glucose transporter-1 SLC2A1/GLUT1, and hence stabilizes and attaches the spectrin-actin network to the erythrocytic plasma membrane. Plays a role in maintaining the functional integrity of PKA-activated erythrocyte shape and the membrane mechanical properties. Plays also a role as a modulator of actin dynamics in fibroblasts; acts as negative regulator of the RhoA activation pathway. In platelets, functions as a regulator of internal calcium mobilization across the dense tubular system that affects platelet granule secretion pathways and aggregation. Also required for the formation of a diverse set of cell protrusions, such as filopodia and lamellipodia, necessary for platelet cell spreading, motility and migration. Acts as a tumor suppressor and inhibits malignant cell transformation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame coding exon in the 3' region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Variants 2, 3 and 10 encode the same isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.