Dcx (NM_001110222) Mouse Untagged Clone

CAT#: MC208370

Dcx (untagged) - Mouse doublecortin (Dcx), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dcx
• Synonyms: Dbct
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208370 representing NM_001110222
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAACTTGATTTTGGACATTTTGACGAACGAGACAAAGCATCTAGAAATATGAGAGGGTCACGGATGA
  ATGGACTTCCAAGTCCCACTCATAGTGCCCACTGTAGCTTCTACAGAACCAGAACCTTGCAGGCATTAAG
  TAATGAGAAGAAGGCCAAGAAGGTACGTTTCTACCGCAATGGGGACCGTTACTTCAAGGGGATTGTGTAC
  GCTGTTTCTTCTGACCGTTTTCGTAGTTTTGATGCGTTGCTGGCTGACCTGACCCGATCCTTGTCTGACA
  ACATTAACCTGCCTCAGGGAGTGCGCTACATTTATACCATTGACGGATCCAGGAAGATTGGAAGCATGGA
  TGAACTGGAAGAAGGGGAAAGCTATGTCTGCTCCTCAGACAACTTCTTTAAAAAGGTTGAGTACACCAAG
  AATGTCAACCCCAACTGGTCTGTCAACGTAAAGACATCTGCCAACATGAAAGCCCCCCAGTCCTTGGCTA
  GCAGCAACAGTGCTCAAGCCAGAGAGAACAAGGACTTTGTGCGCCCCAAACTTGTGACCATCATTCGCAG
  CGGGGTGAAGCCACGGAAGGCTGTGCGCGTGCTTCTCAACAAGAAAACAGCCCACTCTTTCGAGCAGGTC
  CTGACTGACATCACAGAAGCGATCAAACTGGAAACCGGAGTTGTCAAAAAACTCTACACCCTTGATGGAA
  AGCAGGTCACCTGTCTCCATGATTTCTTTGGTGATGATGATGTGTTCATTGCTTGTGGTCCTGAAAAATT
  CCGCTATGCTCAAGATGATTTCTCCTTGGATGAGAATGAATGCAGAGTCATGAAAGGGAATCCATCTGCC
  GCAGCTGGCCCAAAGGCTTCCCCAACACCTCAAAAGACATCTGCTAAAAGCCCAGGCCCAATGCGCCGCA
  GCAAGTCTCCAGCTGACTCAGGTAACGACCAAGACGCAAATGGAACTTCCAGCAGTCAGCTCTCAACACC
  TAAGTCAAAGCAGTCTCCTATCTCTACACCCACAAGCCCTGGAAGTCTGCGGAAGCACAAGGTAGACCTG
  TACCTGCCGCTGTCATTGGATGACTCTGATTCACTTGGCGATTCCATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110222
• Insert Size: 1101 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001110222.1, NP_001103692.1
• RefSeq Size: 9078 bp
• RefSeq ORF: 1101 bp
• Locus ID: 13193
• UniProt ID: O88809
• Cytogenetics: X F2
• Gene Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same isoform (a).