Dcn (NM_001190451) Mouse Untagged Clone

CAT#: MC208369

Dcn (untagged) - Mouse decorin (Dcn), transcript variant 1, (10ug)


  "NM_001190451" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
DCN Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dcn
Synonyms DC; DSPG2; PG40; PGII; PGS2; SL; SLRR1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208369 representing NM_001190451
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGCAACTCTCATCTTCTTCCTTCTGGCACAAGTCTCTTGGGCTGGACCATTTGAACAGAGAGGCT
TATTTGACTTCATGCTAGAAGATGAGGCTTCTGGCATAATCCCTTATGACCCTGACAATCCCCTGATATC
TATGTGCCCCTACCGATGCCAGTGTCATCTTCGAGTGGTGCAGTGTTCTGATCTGGGTTTGGACAAAGTG
CCCTGGGATTTTCCACCCGACACAACCTTGCTAGACCTGCAAAACAACAAAATTACAGAGATCAAAGAAG
GGGCCTTCAAGAACCTGAAGGACTTGCATACCTTGATCCTTGTCAACAACAAGATCAGCAAAATCAGTCC
AGAGGCATTCAAACCTCTCGTGAAGTTGGAAAGGCTTTACCTGTCTAAGAACCAACTAAAGGAACTGCCT
GAAAAAATGCCCAGAACTCTCCAGGAACTTCGTGTCCATGAGAATGAGATCACCAAGCTGCGGAAATCCG
ACTTCAATGGACTGAACAATGTGCTTGTCATAGAACTGGGCGGCAACCCACTGAAAAACTCTGGGATTGA
AAACGGAGCCTTCCAGGGACTGAAGAGTCTCTCATACATTCGCATCTCAGACACCAACATAACTGCGATC
CCTCAAGGTCTGCCTACTTCTCTCACTGAAGTGCATCTAGATGGCAACAAGATCACCAAGGTTGATGCAC
CCAGCCTGAAAGGACTGATTAATTTGTCTAAACTGGGATTGAGCTTCAACAGCATCACCGTTATGGAGAA
TGGCAGTCTGGCCAATGTTCCTCATCTGAGGGAACTCCACTTGGACAACAACAAACTCCTCAGGGTGCCT
GCTGGGCTGGCACAGCATAAGTATATCCAGGTCGTCTACCTTCACAACAACAACATCTCCGCAGTTGGGC
AAAATGACTTCTGCCGAGCTGGACACCCCTCTCGAAAGGCTTCCTACTCGGCTGTGAGTCTTTACGGCAA
CCCTGTCCGGTATTGGGAAATCTTTCCAAACACCTTCAGATGTGTCTATGTGCGTTCTGCCATTCAACTT
GGAAACTACAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001190451
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC132521, AAI32522
RefSeq Size 1520 bp
RefSeq ORF 1065 bp
Locus ID 13179
UniProt ID P28654
Cytogenetics 10 50.27 cM
Gene Summary This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate a mature protein product, which is secreted into the extracellular space to regulate collagen fibril assembly. Homozygous knockout mice for this gene exhibit enhanced tumorigenesis in a liver cancer model, and defects in collagen fibrils, leading to weakened skin and tendons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.