Csnk2b (NM_009975) Mouse Untagged Clone

CAT#: MC208346

Csnk2b (untagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Csnk2b
• Synonyms: CK II beta
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208346 representing NM_009975
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTAGCTCTGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTG
  AGGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCG
  ACAAGCTCTGGACATGATCTTAGACCTGGAACCTGATGAAGAGCTGGAAGACAACCCCAACCAGAGCGAC
  TTGATCGAACAGGCAGCTGAGATGCTTTATGGGTTGATCCACGCCCGCTACATCCTCACCAACCGAGGCA
  TCGCACAAATGTTGGAAAAGTACCAGCAGGGAGACTTTGGCTACTGTCCTCGTGTATACTGTGAGAACCA
  GCCAATGCTTCCTATCGGCCTTTCAGACATCCCAGGCGAGGCCATGGTGAAACTCTACTGCCCCAAGTGC
  ATGGACGTGTACACACCCAAGTCCTCCAGACACCACCACACGGACGGCGCATACTTCGGCACTGGTTTCC
  CTCACATGCTCTTCATGGTGCATCCAGAGTACCGGCCCAAGCGACCTGCCAACCAGTTTGTACCCAGGCT
  CTATGGTTTCAAGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCA
  GTCAAGACTATTCGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009975
• Insert Size: 648 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009975.3, NP_034105.1
• RefSeq Size: 970 bp
• RefSeq ORF: 648 bp
• Locus ID: 13001
• UniProt ID: P67871
• Cytogenetics: 17 18.59 cM
• Gene Summary: This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.