Crem (NM_001110858) Mouse Untagged Clone

CAT#: MC208320

Crem (untagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 6, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Crem (NM_001110858) Mouse Untagged Clone
Symbol Crem
Synonyms ICER; ICERI
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC208320 representing NM_001110858
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCAAATGTGGCAGGAAAAAGTATATGAGGACAAATGTAAGGCAAATGACCATGGAAACAGTTGAAT
CACAGCAGGATCGAAGTGTAACACGTTCTGTGGCAGAGCATAGCTCTGCTCATATGCAGACTGGTCAAAT
TTCTGTTCCTACTCTAGCTCAGGTAGCAACAATTGCAGAGACAGATGATTCTGCAGACTCAGAAGTAATT
GATTCGCATAAACGTAGAGAAATTCTTTCACGAAGACCCTCATATAGAAAAATACTGAATGAACTTTCCT
CTGATGTGCCTGGTATTCCCAAGATTGAAGAAGAAAAATCAGAGGAAGAAGGGACACCACCTAACATTGC
TACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATACACTGCCACAGGTGACATGCCA
ACTTACCAGATCCGAGCTCCTACTACTGCTTTGCCACAAGGTGTGGTGATGGCTGCCTCACCAGGAAGCC
TGCACAGTCCCCAGCAACTAGCAGAAGAAGCAACTCGCAAGCGGGAGCTGAGGCTGATGAAAAACAGGGA
AGCTGCTAAAGAATGTCGACGTCGAAAGAAAGAGTATGTGAAGTGTCTTGAGAGTCGAGTCGCAGTGCTG
GAAGTTCAGAACAAGAAGCTTATAGAGGAGCTTGAAACTTTGAAAGACATTTGCTCTCCCAAAACAGATT
AG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001110858
ORF Size 702 bp
Insert Size 702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001110858.2, NP_001104328
RefSeq Size 1990
RefSeq ORF 702
Locus ID 12916
Cytogenetics 18|18 A1
Gene Summary This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.