Cpa3 (NM_007753) Mouse Untagged Clone

CAT#: MC208312

Cpa3 (untagged) - Mouse carboxypeptidase A3, mast cell (Cpa3), (10ug)

  View "NM_007753" in other vectors (6)

USD 410.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Cpa3 (NM_007753) Mouse Untagged Clone
Symbol Cpa3
Synonyms MC-CPA
Vector pCMV6-Entry
Sequence Data
>MC208312 representing NM_007753
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGTTCTTCTTGCTTATGGCTGTCATCTACACTACACTTGCAATTGCTCCTGTCCACTTTGACAGGG
AGAAGGTATTCCGTGTGAAACTCCAGAATGAAAAGCACGCCAGTGTCTTGAAGAACTTGACCCAAAGCAT
TGAGCTCGACTTCTGGTATCCAGATGCTATCCATGATATTGCTGTGAATATGACTGTGGATTTCCGAGTT
AGTGAGAAGGAATCTCAGACCATCCAGTCAACCTTGGAACAACATAAAATCCATTATGAAATTCTGATAC
ATGACCTACAAGAAGAGATAGAGAAACAGTTTGATGTGAAAGATGAAATCGCAGGCAGGCACAGTTATGC
AAAATACAATGACTGGGACAAGATTGTTTCTTGGACTGAAAAAATGTTAGAAAAACATCCTGAGATGGTT
TCAAGGATTAAAATTGGATCAACTGTTGAAGATAATCCATTATATGTCCTCAAGATTGGGAAAAAAGATG
GAGAAAGAAAGGCTATCTTTATGGACTGTGGCATTCATGCACGTGAATGGATTTCTCCAGCTTTCTGTCA
GTGGTTTGTCTATCAGGCAACCAAGAGTTATGGAAAAAATAAAATCATGACCAAACTCTTGGACCGGATG
AATTTTTACGTTCTGCCTGTATTCAATGTAGACGGATACATTTGGTCATGGACACAGGATCGAATGTGGA
GAAAAAACCGTTCCAGGAACCAAAACTCCACCTGCATTGGCACTGACCTCAACAGGAACTTTGATGTCTC
GTGGGACTCTTCTCCAAACACCAACAAACCATGCCTCAATGTCTACAGGGGACCTGCACCAGAGTCTGAG
AAAGAGACAAAAGCTGTCACCAACTTCATTCGAAGCCATCTGAACTCAATCAAGGCTTATATCACTTTCC
ATTCCTACTCGCAGATGCTATTAATTCCTTATGGCTACACATTCAAACTGCCTCCTAACCACCAGGACCT
ATTGAAAGTTGCAAGGATTGCCACGGATGCTCTCTCAACTAGATATGAAACCCGTTACATCTACGGCCCA
ATAGCATCCACAATTTACAAGACTTCAGGCTCTTCCTTAGACTGGGTTTATGACCTGGGCATCAAACACA
CATTTGCCTTTGAGCTTCGTGATAAAGGAAAGTCTGGGTTTCTTCTTCCAGAATCCCGGATAAAGCCAAC
ATGTAAAGAAACCATGCTTTCTGTCAAATTTATTGCCAAGTATATCCTCAAGAATACTTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_007753
ORF Size 1254 bp
Insert Size 1254
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007753.2, NP_031779
RefSeq Size 1458
RefSeq ORF 1254
Locus ID 12873
Cytogenetics 3 A2|3 6.25 cM
Gene Summary This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases and preproprotein that is proteolytically processed to generate a mature protein product. This product is released by mast cells and may be involved in the degradation of endogenous proteins and the inactivation of venom-associated peptides. Homozygous knockout mice for this gene exhibit impaired mast cell development. [provided by RefSeq, Aug 2015].
Transcript Variant:

Other Versions

Other products for "Cpa3"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies