Cdkn1c (NM_001161624) Mouse Untagged Clone

CAT#: MC208272

Cdkn1c (untagged) - Mouse cyclin-dependent kinase inhibitor 1C (P57) (Cdkn1c), transcript variant 1, (10ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cdkn1c (NM_001161624) Mouse Untagged Clone
Symbol Cdkn1c
Synonyms AL024410; CDKI; Kip2; p57(kip2); p57Kip2
Vector pCMV6-Entry
Sequence Data
>NM_001161624.1
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCATGTCCGACGTGTACCTCCGCAGCAGAACAGCGATGGAACGCTTGGCCTCCAGCGATACCTTCC
CAGTGATAGCGCGTAGCAGCGCCTGCCGCAGCCTCTTCGGGCCTGTAGACCACGAGGAGCTGGGCCGCGA
GCTGCGGATGCGCCTGGCCGAGCTGAACGCCGAGGACCAGAACCGCTGGGACTTCAACTTCCAGCAGGAT
GTGCCTCTTCGAGGCCCTGGTCGTCTGCAGTGGATGGAGGTGGACAGCGAGTCTGTGCCCGCCTTCTACC
GCGAGACGGTGCAGGTGGGGCGCTGTCGCCTGCAGCTGGGGCCCCGGCCACCCCCGGTGGCCGTGGCTGT
CATCCCGCGTTCTGGGCCGCCGGCTGGCGAGGCCCCCGACGGCCTAGAGGAGGCGCCTGAGCAGCCGCCC
AGCGCCCCAGCCTCGGCCGTGGTCGCGGAGCCCACCCCACCCGCGACCCCGGCCCCGGCTTCAGATCTGA
CCTCAGACCCAATTCCGGAGGTGACCCTGGTCGCGACCTCCGACCCGACTCCGGACCCGATCCCGGACGC
GAACCCGGACGTGGCGACTCGGGACGGCGAGGAACAGGTCCCTGAGCAGGTCTCTGAGCAGGGCGAGGAG
TCGGGTGCTGAGCCGGGTGATGAGCTGGGAACTGAGCCGGTCTCTGAGCAGGGCGAGGAGCAGGGCGCAG
AGCCGGTCGAGGAGAAGGACGAGGAGCCGGAGGAGGAGCAGGGCGCGGAGCCGGTCGAGGAGCAGGGTGC
GGAGCCGGTCGAGGAGCAGAATGGGGAGCCGGTCGAGGAGCAGGACGAGAATCAAGAGCAGCGCGGCCAG
GAGCTGAAGGACCAGCCTCTCTCGGGGATTCCAGGACGTCCTGCACCCGGGACTGCTGCGGCCAATGCGA
ACGACTTCTTCGCCAAGCGCAAGAGAACTGCGCAGGAGAACAAGGCGTCGAACGACGTCCCTCCAGGGTG
TCCCTCTCCAAACGTGGCTCCTGGGGTGGGCGCGGTGGAGCAGACCCCGCGCAAACGTCTGAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001161624
ORF Size 1047 bp
Insert Size 1047
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001161624.1, NP_001155096
RefSeq Size 1952
RefSeq ORF 1047
Locus ID 12577
Cytogenetics 7 F5|7 88.22 cM
Gene Summary Potent tight-binding inhibitor of several G1 cyclin/CDK complexes (cyclin E-CDK2, cyclin D2-CDK4, and cyclin A-CDK2) and, to lesser extent, of the mitotic cyclin B-CDC2. Negative regulator of cell proliferation. May play a role in maintenance of the non-proliferative state throughout life. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.