Cd80 (NM_009855) Mouse Untagged Clone

CAT#: MC208260

Cd80 (untagged) - Mouse CD80 antigen (Cd80), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cd80
• Synonyms: B71; Cd28l; Ly-53; Ly53; MIC17; TSA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208260 representing NM_009855
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTTGCAATTGTCAGTTGATGCAGGATACACCACTCCTCAAGTTTCCATGTCCAAGGCTCATTCTTC
  TCTTTGTGCTGCTGATTCGTCTTTCACAAGTGTCTTCAGATGTTGATGAACAACTGTCCAAGTCAGTGAA
  AGATAAGGTATTGCTGCCTTGCCGTTACAACTCTCCTCATGAAGATGAGTCTGAAGACCGAATCTACTGG
  CAAAAACATGACAAAGTGGTGCTGTCTGTCATTGCTGGGAAACTAAAAGTGTGGCCCGAGTATAAGAACC
  GGACTTTATATGACAACACTACCTACTCTCTTATCATCCTGGGCCTGGTCCTTTCAGACCGGGGCACATA
  CAGCTGTGTCGTTCAAAAGAAGGAAAGAGGAACGTATGAAGTTAAACACTTGGCTTTAGTAAAGTTGTCC
  ATCAAAGCTGACTTCTCTACCCCCAACATAACTGAGTCTGGAAACCCATCTGCAGACACTAAAAGGATTA
  CCTGCTTTGCTTCCGGGGGTTTCCCAAAGCCTCGCTTCTCTTGGTTGGAAAATGGAAGAGAATTACCTGG
  CATCAATACGACAATTTCCCAGGATCCTGAATCTGAATTGTACACCATTAGTAGCCAACTAGATTTCAAT
  ACGACTCGCAACCACACCATTAAGTGTCTCATTAAATATGGAGATGCTCACGTGTCAGAGGACTTCACCT
  GGGAAAAACCCCCAGAAGACCCTCCTGATAGCAAGAACACACTTGTGCTCTTTGGGGCAGGATTCGGCGC
  AGTAATAACAGTCGTCGTCATCGTTGTCATCATCAAATGCTTCTGTAAGCACAGAAGCTGTTTCAGAAGA
  AGAAATGAGGCAAGCAGAGAAACAAACAACAGCCTTACCTTCGGGCCTGAAGAAGCATTAGCTGAACAGA
  CCGTCTTCCTTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009855
• Insert Size: 924 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC145843, AAI45844
• RefSeq Size: 1701 bp
• RefSeq ORF: 921 bp
• Locus ID: 12519
• UniProt ID: Q00609
• Cytogenetics: 16 26.86 cM
• Gene Summary: Involved in the costimulatory signal essential for T lymphocytes activation. T-cell proliferation and cytokine production is induced by the binding of CD28 or CTLA-4 to this receptor.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species, a strong Kozak signal and on a higher probability of an N-terminal signal peptide being present in the resulting protein. An upstream in-frame start codon is also present but has a weaker Kozak signal and is only present in mouse; use of the upstream start codon would result in a protein that is 8 aa longer at the N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.