Cd79a (NM_007655) Mouse Untagged Clone

CAT#: MC208259

Cd79a (untagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cd79a
• Synonyms: Ig-alpha; Iga; Igalpha; Ly-54; Ly54; mb-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NM_007655.3
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCAGGGGGTCTAGAAGCCCTCAGAGCCCTGCCTCTCCTCCTCTTCTTGTCATACGCCTGTTTGGGTC
  CCGGATGCCAGGCCCTGCGGGTAGAAGGGGGTCCACCATCCCTGACGGTGAACTTGGGCGAGGAGGCCCG
  CCTCACCTGTGAAAACAATGGCAGGAACCCTAATATCACATGGTGGTTCAGCCTTCAGTCTAACATCACA
  TGGCCCCCAGTGCCACTGGGTCCTGGCCAGGGTACCACAGGCCAGCTGTTCTTCCCCGAAGTAAACAAGA
  ACCACAGGGGCTTGTACTGGTGCCAAGTGATAGAAAACAACATATTAAAACGCTCCTGTGGTACTTACCT
  CCGCGTGCGCAATCCAGTCCCTAGGCCCTTCCTGGACATGGGGGAAGGTACCAAGAACCGCATCATCACA
  GCAGAAGGGATCATCTTGCTGTTCTGTGCAGTGGTGCCAGGGACGCTGCTGCTATTCAGGAAACGGTGGC
  AAAATGAGAAGTTTGGGGTGGACATGCCAGATGACTATGAAGATGAAAATCTCTATGAGGGCCTGAACCT
  TGATGACTGTTCTATGTATGAGGACATCTCCAGGGGACTCCAGGGCACCTACCAGGATGTGGGCAACCTC
  CACATTGGAGATGCCCAGCTGGAAAAGCCATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_007655
• Insert Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_007655.3, NP_031681.2
• RefSeq Size: 1327 bp
• RefSeq ORF: 663 bp
• Locus ID: 12518
• UniProt ID: P11911
• Cytogenetics: 7 13.49 cM
• Gene Summary: Required in cooperation with CD79B for initiation of the signal transduction cascade activated by binding of antigen to the B-cell antigen receptor complex (BCR) which leads to internalization of the complex, trafficking to late endosomes and antigen presentation. Also required for BCR surface expression and for efficient differentiation of pro- and pre-B-cells. Stimulates SYK autophosphorylation and activation. Binds to BLNK, bringing BLNK into proximity with SYK and allowing SYK to phosphorylate BLNK. Also interacts with and increases activity of some Src-family tyrosine kinases. Represses BCR signaling during development of immature B-cells.[UniProtKB/Swiss-Prot Function]