Bcl2 (NM_177410) Mouse Untagged Clone
CAT#: MC208179
Bcl2 (untagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2, (10ug)
"NM_177410" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Bcl2 |
Synonyms | AW986256; Bcl-; Bcl-2; C430015F12Rik; D630044D05Rik; D830018M01Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_177410.2
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCAAGCCGGGAGAACAGGGTATGATAACCGGGAGATCGTGATGAAGTACATACATTATAAGCTGT CACAGAGGGGCTACGAGTGGGATGCTGGAGATGCGGACGCGGCGCCCCTGGGGGCTGCCCCCACCCCTGG CATCTTCTCCTTCCAGCCTGAGAGCAACCCAATGCCCGCTGTGCACCGGGACATGGCTGCCAGGACGTCT CCTCTCAGGCCCCTCGTTGCCACCGCTGGGCCTGCGCTCAGCCCTGTGCCACCTGTGGTCCATCTGACCC TCCGCCGGGCTGGGGATGACTTCTCTCGTCGCTACCGTCGTGACTTCGCAGAGATGTCCAGTCAGCTGCA CCTGACGCCCTTCACCGCGAGGGGACGCTTTGCCACGGTGGTGGAGGAACTCTTCAGGGATGGGGTGAAC TGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACAGGGAGATGT CACCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCATCTGCACACCTGGATCCA GGATAACGGAGGCTGGGTAGGTGCATGTCTGGTTGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_177410 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_177410.2, NP_803129.2 |
RefSeq Size | 2529 bp |
RefSeq ORF | 600 bp |
Locus ID | 12043 |
Cytogenetics | 1 49.76 cM |
Gene Summary | This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226785 | Bcl2 (tGFP-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2) transcript variant 2, (10ug) |
USD 650.00 |
|
MR226785 | Bcl2 (Myc-DDK-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 |
USD 450.00 |
|
MR226785L3 | Lenti ORF clone of Bcl2 (Myc-DDK-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 |
USD 750.00 |
|
MR226785L4 | Lenti ORF clone of Bcl2 (mGFP-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review