Ak4 (NM_001177605) Mouse Untagged Clone

CAT#: MC208122

Ak4 (untagged) - Mouse adenylate kinase 4 (Ak4), nuclear gene encoding mitochondrial protein, transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ak4
• Synonyms: Ak-3; Ak-4; Ak3; Ak3l1; AK 4; D4Ertd274e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208122 representing NM_001177605
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTTCCAAACTCCTGCGCGCGGTCATCCTCGGGCCGCCCGGCTCTGGCAAGGGCACCGTTTGCGAAA
  GGATCGCCCAGAACTTTGGCCTCCAGCATCTCTCCAGCGGCCACTTGTTGCGGGAGAACCTCAAGACCGG
  CACGGAAGTTGGTGACGTGGCAAAACAGTACCTAGAAAAAGGTCTTTTGGTTCCAGATCACGTGATCACA
  CGCCTAATGATGTCAGAACTGGAGACTCGGAGTGCCCAGCACTGGCTGTTAGATGGATTCCCGAGGACAT
  TAGTACAGGCAGAAGCCCTGGACGGAATCTGTGATGTGGACCTAGTAATCAGTTTGAATATTCCTTTTGA
  GACACTTAAAGATCGTCTGAGCCGACGGTGGATTCACCCTTCTAGCGGGAGGGTCTATAACCTGGACTTC
  AACCCACCTCAAGTGCAGGGGATTGATGACATCACTGGTGAGCCACTTGTCCAACAGGAAGATGATAAAC
  CTGAAGCAGTTGCTGCCAGGCTAAGACGGTACAAGGATGCGGCAAAACCAGTCATCGAACTGTACAAGAG
  CCGTGGAGTGCTCCACCAGTTTTCTGGGACGGAGACTAACAGAATCTGGCCTTATGTTTACACACTTTTC
  TCCAACAAGATCACACCTATTCAATCCAAAGAAGCCTACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001177605
• Insert Size: 672 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001177605.1, NP_001171076.1
• RefSeq Size: 4927 bp
• RefSeq ORF: 672 bp
• Locus ID: 11639
• UniProt ID: Q9WUR9
• Cytogenetics: 4 46.84 cM
• Gene Summary: Involved in maintaining the homeostasis of cellular nucleotides by catalyzing the interconversion of nucleoside phosphates. Efficiently phosphorylates AMP and dAMP using ATP as phosphate donor, but phosphorylates only AMP when using GTP as phosphate donor. Also displays broad nucleoside diphosphate kinase activity.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein.