Capzb (NM_009798) Mouse Untagged Clone

CAT#: MC207998

Capzb (untagged) - Mouse capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Capzb
• Synonyms: 1700120C01Rik; AI325129; Cap; Cappb1; CPB; CPB1; CPB2; CPbeat2; CPbet; CPbeta1; CPbeta2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207998 representing NM_009798
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGATCAGCAGCTGGACTGCGCCTTGGACCTGATGAGGCGCCTGCCTCCACAGCAGATTGAGAAGA
  ACCTCAGCGATCTGATCGACCTGGTCCCCAGTCTGTGTGAAGATCTCCTGTCATCTGTTGACCAGCCCCT
  GAAAATTGCCAGAGACAAGGTGGTGGGCAAGGATTACCTTTTGTGTGACTACAACAGAGACGGGGACTCC
  TATAGGTCACCGTGGAGTAACAAGTATGACCCTCCTTTGGAAGATGGGGCCATGCCATCTGCTCGGCTCA
  GAAAGCTGGAGGTAGAGGCCAACAATGCCTTCGACCAATACCGAGACCTGTATTTTGAAGGTGGGGTCTC
  ATCAGTCTACCTCTGGGATCTTGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAAGCTGGAGATGGA
  TCCAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTGGAAGTGCAGGAGAAGTCCAGCGGCCGTA
  CTGCCCATTACAAGTTGACCTCCACGGTGATGCTATGGCTGCAAACCAACAAATCCGGCTCGGGCACCAT
  GAACCTGGGAGGCAGCCTAACCAGACAGATGGAGAAAGACGAAACTGTGAGTGACTGTTCCCCACACATA
  GCCAACATCGGGCGCCTGGTGGAGGACATGGAAAACAAAATCCGAAGCACGCTGAATGAGATCTACTTTG
  GAAAAACAAAGGACATCGTCAACGGGCTGAGGTCTGTGCAGACGTTTGCAGACAAATCAAAGCAAGAAGC
  GCTTAAGAACGACCTGGTGGAGGCCTTGAAGAGAAAGCAGCAGTGTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009798
• Insert Size: 819 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009798.4, NP_033928.1
• RefSeq Size: 1676 bp
• RefSeq ORF: 819 bp
• Locus ID: 12345
• UniProt ID: P47757
• Cytogenetics: 4 70.59 cM
• Gene Summary: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, which results in translation extending to a distinct 3' coding region compared to variant 1. The encoded isoform (b) is shorter than and has a distinct C-terminus compared to isoform a.