Rhox4a (NM_001039688) Mouse Untagged Clone

CAT#: MC207983

Rhox4a (untagged) - Mouse reproductive homeobox 4A (Rhox4a), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rhox4a (NM_001039688) Mouse Untagged Clone
Symbol Rhox4a
Synonyms Rhox4; Rhox4.1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC207983 representing NM_001039688
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCATCAAAACACCAACTACCTACTTCATGAGGGACTTGGCAAGGACAAGGAAAATTTGAATGGTG
GGAAGACACAGGCAGTCTTACCACTGGATGGAGAGGGAAGAAATGAGGGAGAGAGTGTACTGGGCCAGTC
CGGAGCCGCAGCAGTGGAAGGGGACAAAGCAGAAGAATTAAGTGGAGAAGGTGGGCCTGCTGCTGGTGAT
GCAGACCTCATGGATAACAGCAACCAAGAGGACCAGGACACCAGTGGCAGTGCCCAGGAGGAGGAGAAGC
TGCCAGAGGAGCCAGTTCTCAAGGATGCTGTGGTCATAGACAAAGTGCAGCCTATTCCAGTGCTGGTATC
TGGTGTGCGGCCTAAGTCAGTGTGGGTACAGCAGCGTAGCTTACACTACAATTTCCAATGGTGGCAGCTG
CAGGAGCTGGAGCGCATTTTCCAGCAGAATCACTTCATCCGTGCAGAGGAAAGAAGACATCTGGCAAGAT
GGATAGGTGTGAGTGAAGCCAGAGTTAAGAGATGGTTTAAGAAGAGGAGAGAGCACTTCAGAAGAGGACA
AAGTCAGTTAGGAATGAATGATGACGCCTCTGTGGGGTCCCACTCTACCTTTCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001039688
ORF Size 618 bp
Insert Size 618
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001039688.3, NP_001034777
RefSeq Size 891
RefSeq ORF 618
Locus ID 664609
Cytogenetics X|X A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.