Tor1aip2 (NM_022329) Mouse Untagged Clone

SKU
MC207928
Tor1aip2 (untagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 2, (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tor1aip2
Synonyms 15kDa; 1110020D10Rik; A130072J07; AA103493; AW060462; AW610675; C77739; Ifrg15; Lull1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207928 representing NM_022329
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCTCCGATAATTCACACTGCCCTGATTGTGGGCAGCAGTGGTTCCCTAGTTTAGAACTAGGGCACT
GGTTGTACCAAACTGAACTTGTTGAAAATGAATGTTACCAAGTGTTCTTAGACCGTATTAACAGGGCTGA
CTACTGCCCTGAGTGTTACCCTGACAATCCTGCTAATAGAAGCCTTGTTCTGCCTTGGTCTTTCCCACTT
GAGTGGGCACCTCAAAATCTTACCAGGTGGACCTTTGAAAAAGCTTGCCATCCATTTCTTCTGGGTCCTC
CACTGGTTAGAAAAAAGATACATGACTCCAGGGTAGCTGGCTTTAATCCTGCATTACAATTAATTTTGTC
CAGAACAGACAAAACCTTAAACAAGAAACTTGGCCAAAGCAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_022329
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022329.4, NP_071724.1
RefSeq Size 2585 bp
RefSeq ORF 396 bp
Locus ID 240832
UniProt ID Q9ER81
Cytogenetics 1 G3
Summary Required for endoplasmic reticulum integrity. Regulates the distribution of TOR1A between the endoplasmic reticulum and the nuclear envelope as well as induces TOR1A, TOR1B and TOR3A ATPase activity (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) shares a portion of its 5' UTR, but uses a completely different set of coding exons compared to variant 5. Variant 2 encodes a shorter protein (interferon alpha responsive protein), which is distinct from torsin A interacting protein 2). Variants 1-4 encode the same protein (isoform a).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_022329" in other vectors (4)
SKU Description Size Price
MG200751 Tor1aip2 (tGFP-tagged) - Mouse interferon alpha responsive gene (Ifrg15) 10 ug
$350.00
MR200751 Tor1aip2 (Myc-DDK-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 2 10 ug
$289.00
MR200751L3 Lenti ORF clone of Tor1aip2 (Myc-DDK-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 2 10 ug
$450.00
MR200751L4 Lenti ORF clone of Tor1aip2 (mGFP-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 2 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products