Panx3 (NM_172454) Mouse Untagged Clone

CAT#: MC207856

Panx3 (untagged) - Mouse pannexin 3 (Panx3), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Panx3 (NM_172454) Mouse Untagged Clone
Symbol Panx3
Synonyms 3230401P04; 4833413G11Rik
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC207856 representing NM_172454
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGCTCGCACACACTGCTGCAGAGTACATGCTCTCTGATGCCCTGCTGCCTGACCGCAGGGGCTCTC
GGCTCAAAGGACTGCGCCTGGAACTGCCCCTGGATAAGATGGTCAAGTTCATTACTGTGGGCTTTCCCTT
GCTGCTGATGTCTCTAGCTTTCGCCCAGGAGTTCTCATCAGGGTCTCCGATCAGCTGTTTCTCTCCCAGC
AACTTCAGTGTCAGGCAGGCTGCATACGTGGATAGCTCATGCTGGGACTCGCTGGCTCACCATACGCAGG
ACAAGGCTGGCCAGTACAAGGTGAAATCTCTCTGGCCTCACAAGGCTCTTCCCTACTCTCTACTGGCTCT
GGCTGTGGCCATGTATCTGCCAGTGTTGCTGTGGCAATATGTAGCTGTGCCCTCCCTCAGCTCTGACCTG
CTGTTCATCATCAGTGAGCTGGACAAGTCTTACAACCGTTCCATCCGCCTGGTGCAGCACATGTTGCAGA
TCCGGCAGAGCAGCTCTGACCCCCATGTCTTCTGGGATGAGCTAGAGAAGGCCCGGAAGGAACGGTACTT
TGAATTTCCCTTGCTAGAGCGGTACCTGGAATGCAAGCAGCGCTCCCATTGGCTAGTGGCCACCTACCTC
CTGAGGAACGCCCTCTTACTCCTCTTTACCTCAGCCACTTACCTGTACCTTGGCCAATTCCATTTAGATG
TCTTCTTTCAAGACGAATTTAACTGCTTCATCAAGACAGGGCTGCTACATGATGAGACCCATGTGCCAGA
GCTGATCACATGCAGGCTGACCTCCCTGTCTGTATTCCAGATTGTGAGTGTCTCCAGTGCAGCAATATAC
ACCATATTGGTCCCAGTGATAATATACAACCTCACACGGCTATGTCGGTGGGACAAAGGACTCCTATCCA
TCTATGAGATGCTCCCAGCTTTTGATCTCCTCAGTAGAAAGATGCTAGGATGCCCCATCAATGACCTCAA
TGTGATTCTTCTTTTCCTCCGAGCTAATATCTCTGAGCTCATCTCTTTTAGCTGGCTGAGTGTCTTAAGT
GTGTTGAAGGATACAACCACCCAGAAACACAACATCGACACAGTGGTTGACTTTATGACCTTTGTGGCTG
GCTTAGAACCCTCAAAACCTAAACATCTCACCCAACATACATATGATGAACACGCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172454
ORF Size 1179 bp
Insert Size 1179
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172454.2, NP_766042
RefSeq Size 2518
RefSeq ORF 1179
Locus ID 208098
Cytogenetics 9|9 A4
Gene Summary Structural component of the gap junctions and the hemichannels. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.