Tpbpb (NM_026429) Mouse Untagged Clone

CAT#: MC207846

Tpbpb (untagged) - Mouse trophoblast specific protein beta (Tpbpb), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tpbpb (NM_026429) Mouse Untagged Clone
Symbol Tpbpb
Synonyms 1600012N09Rik
Vector pCMV6-Entry
Sequence Data
>MC207846 representing NM_026429
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTCCTACAGTCTTCTTGGTCATCCTGTGCCTGGGTGTGGCCTCAGCTGCTATAATCCCTGAACCAA
CTTTGGATACTGAAGTGCAAGAGCAGAAGGATAAAGAAGGACTCAAAAAAGCAACGTGGAATGAGTTTGT
CATGAAACTGAACAATAGCAAAAATGACCAGGAGAAGGATGGCATCGACATAGAATTGAGAGTCTTCTTT
GGTCAGCTGACTGATGAAGAACTAATGAAAATAATGACTAACATTTTCCACCCAATGTTGGAAGAGGAGA
AAACACAGCCAGTTGTTGATGACCCTGAATTTGAGGATTACACAGAGAGTGGCGATGGGTTTTTTGTACC
AAATCAGCCACAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_026429
ORF Size 366 bp
Insert Size 366
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_026429.4, NP_080705
RefSeq Size 736
RefSeq ORF 366
Locus ID 116913
Cytogenetics 13|13 B2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.