Otub1 (NM_134150) Mouse Untagged Clone

CAT#: MC207822

Otub1 (untagged) - Mouse OTU domain, ubiquitin aldehyde binding 1 (Otub1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Otub1
• Synonyms: AI850305
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207822 representing NM_134150
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGCGGAGGAACCTCAGCAGCAGAAGCAGGAGCCACTGGGTAGCGACTCCGAAGGTGTTAACTGTT
  TGGCCTATGATGAAGCCATTATGGCTCAGCAGGACCGAATTCAGCAAGAGATTGCTGTGCAGAATCCTCT
  GGTGTCAGAGCGGCTGGAACTCTCAGTCCTGTACAAGGAGTATGCTGAGGATGACAACATCTACCAACAG
  AAGATCAAGGACCTCCACAAAAAGTACTCATACATACGGAAGACCCGGCCTGATGGCAACTGCTTCTACC
  GAGCGTTTGGCTTCTCCCACCTGGAGGCACTGCTAGATGACAGCAAGGAACTGCAGCGGTTCAAAGCCGT
  GTCTGCCAAGAGTAAAGAGGACCTGGTATCCCAGGGCTTCACTGAATTCACAATTGAAGACTTCCACAAC
  ACGTTCATGGACCTTATCGAGCAGGTGGAGAAGCAGACCTCAGTAGCTGACCTGCTGGCCTCCTTCAATG
  ACCAGAGCACCTCAGACTACCTTGTGGTCTACCTGCGACTGCTCACCTCAGGCTACCTACAGCGGGAGAG
  CAAGTTCTTCGAGCACTTCATCGAGGGTGGCCGGACTGTTAAGGAGTTCTGCCAGCAGGAGGTGGAACCC
  ATGTGCAAGGAGAGCGACCACATCCACATCATAGCCCTGGCCCAGGCCCTCAGTGTGTCCATCCAAGTGG
  AGTACATGGACCGCGGCGAGGGCGGCACCACCAACCCACACGTCTTCCCCGAGGGCTCCGAGCCCAAGGT
  CTACCTTCTCTACCGACCTGGACACTACGATATCCTCTACAAATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_134150
• Insert Size: 816 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_134150.2, NP_598911.1
• RefSeq Size: 1677 bp
• RefSeq ORF: 816 bp
• Locus ID: 107260
• UniProt ID: Q7TQI3
• Cytogenetics: 19 A
• Gene Summary: Hydrolase that can specifically remove compared to 'Lys-48'-linked conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. Regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. Acts via its interaction with RNF128/GRAIL. Surprisingly, it regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). Mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. Not able to cleave di-ubiquitin. Also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.[UniProtKB/Swiss-Prot Function]