Tecr (NM_134118) Mouse Untagged Clone

CAT#: MC207818

Tecr (untagged) - Mouse trans-2,3-enoyl-CoA reductase (Tecr), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tecr
• Synonyms: 2410016D23Rik; A230102P12Rik; AI173355; D17Ertd178e; Gpsn2; SC2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207818 representing NM_134118
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGCACTACGAGGTGGAGATTCGGGATGCAAAGACGAGGGAGAAGCTGTGCTTCCTGGACAAGGTAG
  AGCCTCAGGCCACCATTTCTGAAATCAAGACCCTTTTCACCAAGACACACCCGCAGTGGTATCCTGCCCG
  CCAGTCCCTCCGCCTGGACCCCAAGGGGAAGTCCCTGAAAGATGAAGATGTCTTACAGAAGCTTCCTGTG
  GGCACCACAGCCACACTCTACTTCCGGGACCTCGGGGCCCAGATCAGCTGGGTGACGGTCTTCCTGACGG
  AGTATGCCGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTACCCTTCATTTATGGCCGCAAATA
  CGACTTTACGTCCAGTCGGCATACGGTGGTGCACCTCGCCTGCATGTGCCACTCGTTCCACTACATCAAG
  CGCCTGCTGGAGACTCTCTTCGTGCACCGATTCTCTCACGGAACCATGCCTTTGCGAAACATCTTCAAAA
  ACTGCACCTACTATTGGGGCTTTGCTGCATGGATGGCTTATTACATCAACCACCCTCTCTACACACCCCC
  TACCTATGGAGTTCAGCAGGTTAAGCTGGCACTGGCCGTTTTTGTGATCTGCCAGCTTGGGAACTTCTCC
  ATCCACATGGCTCTTCGGGACCTTCGGCCTGCTGGGTCGAAAACCAGGAAGATCCCATACCCCACCAAGA
  ACCCCTTCACCTGGCTGTTCCTGTTGGTGTCCTGTCCCAACTACACTTATGAGGTGGGCTCCTGGATTGG
  CTTTGCCATCTTGACTCAGTGTGTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATC
  TGGGCCAAGGGCAAACACCGCAGCTACCTGAAGGAGTTCCGCGACTACCCGCCCCTGCGCATGCCCATTA
  TTCCCTTCCTGCTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_134118
• Insert Size: 927 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_134118.5, NP_598879.1
• RefSeq Size: 1190 bp
• RefSeq ORF: 927 bp
• Locus ID: 106529
• UniProt ID: Q9CY27
• Cytogenetics: 8 40.22 cM
• Gene Summary: Involved in both the production of very long-chain fatty acids for sphingolipid synthesis and the degradation of the sphingosine moiety in sphingolipids through the sphingosine 1-phosphate metabolic pathway (By similarity). Catalyzes the last of the four reactions of the long-chain fatty acids elongation cycle (By similarity). This endoplasmic reticulum-bound enzymatic process, allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle (By similarity). This enzyme reduces the trans-2,3-enoyl-CoA fatty acid intermediate to an acyl-CoA that can be further elongated by entering a new cycle of elongation (By similarity). Thereby, it participates in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators (By similarity). Catalyzes the saturation step of the sphingosine 1-phosphate metabolic pathway, the conversion of trans-2-hexadecenoyl-CoA to palmitoyl-CoA (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).