OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rps27a (NM_001033865) Mouse Untagged Clone

Be the first to review this product
SKU
MC207773
Rps27a (untagged) - Mouse ribosomal protein S27A (Rps27a), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $165.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rps27a or NM_001033865"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rps27a
Synonyms 0610006J14Rik; Uba52; Ubb; Ubc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207773 representing NM_001033865
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGATCTTTGTGAAGACCCTTACGGGGAAAACCATCACGCTCGAGGTTGAACCCTCGGACACTATAG
AAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGGCTGATCTTTGCTGG
TAAGCAGCTGGAAGATGGCCGGACTTTGTCTGACTACAACATTCAAAAGGAGTCCACCCTTCATCTGGTG
TTGAGACTTCGGGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAACAAGCATA
AGAGGAAGAAGGTTAAGTTGGCTGTGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATTAGCCGACT
TCGTCGAGAGTGTCCTTCTGATGAATGTGGTGCTGGAGTTTTCATGGGAAGCCACTTTGACAGGCATTAC
TGTGGCAAGTGTTGTCTGACTTACTGCTTCAACAAACCAGAAGACAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001033865
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033865.1, NP_001029037.1
RefSeq Size 821 bp
RefSeq ORF 471 bp
Locus ID 78294
UniProt ID P62983
Cytogenetics 11 A3.3
Summary Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033865" in other vectors (3)
SKU Description Size Price
MR201163 Rps27a (Myc-DDK-tagged) - Mouse ribosomal protein S27A (Rps27a), transcript variant 2 10 ug
$289.00
MR201163L3 Lenti ORF clone of Rps27a (Myc-DDK-tagged) - Mouse ribosomal protein S27A (Rps27a), transcript variant 2 10 ug
$450.00
MR201163L4 Lenti ORF clone of Rps27a (mGFP-tagged) - Mouse ribosomal protein S27A (Rps27a), transcript variant 2 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products