Phpt1 (NM_029293) Mouse Untagged Clone

CAT#: MC207752

Phpt1 (untagged) - Mouse phosphohistidine phosphatase 1 (Phpt1), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Phpt1 (NM_029293) Mouse Untagged Clone
Symbol Phpt1
Synonyms 1700008C22Rik; PHP; Php14
Vector pCMV6-Entry
Sequence Data
>MC207752 representing NM_029293
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGACCTCGGTCAGATTCCTGATGTAGACATTGATTCGGATGGCGTCTTCAAGTATGTGCTGA
TTCGAGTCCACTTAGCAGAGCCTTCTGGGGATCCGGCGAAGGAGTGCAAGGAAATCGTGCGTGGCTACAA
ATGGGCTGAGTACCACGCGGACATCTATGACAAAGTGTCAGGCGAGCTGCAAAGGAATGGCTATGACTGT
GAGTGCCTAGGCGGCGGGCGCATCTCCCATCAGAGCCAGGACAGGAAGATACACGTGTATGGCTACTCTA
TGGGTTACGGTCGTGCCCAGCACTCTGTTTCAACTGAGAAGATCAAAGCCAAGTATCCTGACTATGAGGT
CACCTGGGCTGACGATGGCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029293
ORF Size 375 bp
Insert Size 375
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029293.2, NP_083569
RefSeq Size 583
RefSeq ORF 375
Locus ID 75454
Cytogenetics 2|2 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.