Cyb5r1 (NM_028057) Mouse Untagged Clone

CAT#: MC207712

Cyb5r1 (untagged) - Mouse cytochrome b5 reductase 1 (Cyb5r1), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cyb5r1 (NM_028057) Mouse Untagged Clone
Symbol Cyb5r1
Synonyms 1500005G05Rik; B5R.1; C80155; Nqo3a2
Vector pCMV6-Entry
Sequence Data
>MC207712 representing NM_028057
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGATCCAGCCGAGCCCGGTCTTGCTAGCCTCTCTGGGGGTGGGGCTGCTTACTCTGCTCGGCCTGG
CTCTGGGTACCTACTTGGTTCGAAGATCCCGCCGGCCGCAGGTTACTCTCCAGGACCCGGATGAGAAGTA
CCTGCTGCGATTGCTAGACAAGACGACAGTGAGCCACAACACCAGGAGGTTCCGCTTTGCCTTGCCCACC
GCCCACCACATTCTGGGGCTGCCTGTGGGTAAGCACGTCTACCTCTCTGCCCGAATTGATGGCAGTCTGG
TCATCAGGCCTTACACCCCTGTCACCAGTGATGAAGACCAAGGCTATGTAGATCTTGTCATCAAGGTTTA
TCTGAAAGGTGTGCACCCCAAATTTCCTGAAGGAGGGAAGATGTCTCAATACCTGGATAGCCTGAAGATT
GGGGATATGGTGGAGTTCCGGGGGCCGAGCGGGTTGCTCAGTTATGCTGGGAAAGGGAATTTTAATATTC
AGCCCAACAAAAAATCTCCACCTGAACTGCGAGTGGCGAAGAAATTGGGAATGATTGCTGGTGGGACAGG
AATCACCCCAATGCTGCAGCTGATCCGGGCCATCTTGAAAGTCCCTGAAGATCCAACCCAGTGCTTTCTG
CTTTTTGCCAACCAGACTGAAAGGGATATAATCCTGCGGGAGGACCTAGAGGAACTTCAGGCCCAGTATC
CTAATCGCTTTAAGCTCTGGTTCACTCTGGACTCTCCTCCAGAAGACTGGACCTACAGCAAGGGCTTTGT
TACGGCTGACATGATCCAGGAGCACCTGCCTGCCCCAGCAGAGGATGTGCTGCTGCTGCTCTGTGGACCA
CCACCCATGGTGCAGCTGGCCTGCCACCCTAACTTGGATAAGCTGGGCTATTCACAAAAGATGCGATTCA
CCTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_028057
ORF Size 918 bp
Insert Size 918
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_028057.2, NP_082333
RefSeq Size 1626
RefSeq ORF 918
Locus ID 72017
Cytogenetics 1|1 E4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.