Kctd6 (NM_027782) Mouse Untagged Clone

CAT#: MC207706

Kctd6 (untagged) - Mouse potassium channel tetramerisation domain containing 6 (Kctd6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kctd6
• Synonyms: 5430433B02Rik; AU044285
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207706 representing NM_027782
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATAATGGGGACTGGGGCTATATGATGAGTGACCCAGTCACATTAAATGTAGGTGGACACTTGTACA
  CGACATCGCTTACCACGTTGACACGCTACCCGGATTCTATGCTTGGAGCTATGTTTGGGGGTGACTTCCC
  CACAGCCCGAGACCCTCAAGGCAATTACTTCATTGATCGAGACGGACCGCTCTTCCGCTATGTCCTTAAC
  TTCCTACGGACTTCAGAACTGACACTCCCCCTGGACTTTAAGGAGTTTGATCTGCTTCGGAAAGAGGCTG
  ATTTCTACCAGATCGAACCCTTGATTCAGTGTCTCAATGACCCCAGGCCTCTGTATCCTATGGATACTTT
  TGAAGAAGTCGTAGAGCTGTCTAGCACTCGGAAGCTTTCTAAATATTCCAATCCGGTGGCCGTCATCATC
  ACCCAGTTAACCATCACCACAAAGGTCCACTCCTTACTCGAAGGCATCTCAAACTATTTCACCAAGTGGA
  ATAAGCACATGATGGACACCAGAGACTGCCAGGTCTCCTTCACCTTTGGACCGTGCGATTACCACCAGGA
  AGTCTCTCTCCGGGTCCATCTGATGGAGTACATCACGAAGCAAGGTTTCACGATCCGCAATACTCGGGTG
  CATCACATGAGCGAGCGGGCCAATGAGAACACAGTAGAGCACAACTGGACTTTCTGTAGACTGGCCCGCA
  AGACGGACGACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027782
• Insert Size: 714 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027782.3, NP_082058.1
• RefSeq Size: 1734 bp
• RefSeq ORF: 714 bp
• Locus ID: 71393
• UniProt ID: Q8BNL5
• Cytogenetics: 14 A1
• Gene Summary: Probable substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex mediating the ubiquitination and subsequent proteasomal degradation of target proteins. Promotes the ubiquitination of HDAC1; the function seems to depend on KCTD11:KCTD6 oligomerization. Can function as antagonist of the Hedgehog pathway by affecting the nuclear transfer of transcription factor GLI1; the function probably occurs via HDAC1 down-regulation, keeping GLI1 acetylated and inactive. Inhibits cell growth and tumorigenicity of medulloblastoma (MDB). Involved in regulating protein levels of ANK1 isoform Mu7 probably implicating CUL3-dependent proteasomal degradation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1-3 encode the same protein.