Rnf41 (NM_026259) Mouse Untagged Clone

CAT#: MC207629

Rnf41 (untagged) - Mouse ring finger protein 41 (Rnf41), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnf41
• Synonyms: 2210404G21Rik; 4930511A05Rik; 4933415P08Rik; D10Ertd722e; FLRF; Nrdp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207629 representing NM_026259
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGTATGATGTGACCCGTTTCCAGGGGGACGTTGACGAGGACCTTATCTGCCCTATTTGCAGTGGAG
  TCTTGGAGGAGCCAGTGCAGGCGCCTCATTGTGAGCATGCCTTCTGCAACGCCTGCATCACCCAATGGTT
  CTCTCAGCAGCAGACGTGTCCGGTAGACCGTAGCGTTGTCACGGTTGCCCACCTGCGCCCAGTACCTCGG
  ATCATGCGGAACATGTTGTCAAAGCTACAGATTGCCTGTGACAACGCTGTGTTTGGCTGCAGTGCTGTTG
  TCAGGCTTGACAACCTCATGTCCCACCTCAGTGACTGTGAGCACAACCCGAAGCGGCCTGTGACCTGTGA
  GCAGGGCTGTGGCCTGGAGATGCCCAAAGATGAACTGCCAAACCACAATTGCATTAAGCACCTGCGCTCC
  GTGGTCCAGCAGCAGCAGTCGCGCATTGCAGAGCTGGAGAAGACCTCGGCTGAACACAAGCACCAGCTGG
  CAGAGCAGAAGCGAGACATTCAGCTGCTGAAGGCGTATATGCGAGCCATCCGCAGTGTCAACCCCAACCT
  TCAGAACCTGGAGGAGACAATCGAATACAATGAGATCCTCGAGTGGGTGAACTCCCTGCAGCCGGCAAGG
  GTGACCCGCTGGGGGGGCATGATCTCCACTCCTGATGCTGTGCTCCAGGCTGTCATCAAGCGCTCCCTCG
  TGGAAAGTGGCTGCCCGGCCTCCATCGTCAACGAGCTGATTGAAAATGCCCATGAACGCAGCTGGCCCCA
  GGGTCTGGCCACACTAGAGACAAGACAGATGAACCGGCGCTACTATGAGAACTACGTGGCCAAGCGCATC
  CCTGGCAAGCAGGCTGTAGTGGTGATGGCCTGTGAGAACCAGCACATGGGGGACGACATGGTGCAGGAGC
  CAGGGCTCGTCATGATATTTGCGCATGGTGTGGAGGAGATATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_026259
• Insert Size: 954 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_026259.3, NP_080535.2
• RefSeq Size: 3341 bp
• RefSeq ORF: 954 bp
• Locus ID: 67588
• UniProt ID: Q8BH75
• Cytogenetics: 10 76.55 cM
• Gene Summary: Acts as E3 ubiquitin-protein ligase and regulates the degradation of target proteins. Polyubiquitinates MYD88 (By similarity). Negatively regulates MYD88-dependent production of proinflammatory cytokines. Can promote TRIF-dependent production of type I interferon and inhibits infection with vesicular stomatitis virus. Promotes also activation of TBK1 and IRF3 (PubMed:19483718). Involved in the ubiquitination of erythropoietin (EPO) and interleukin-3 (IL-3) receptors. Thus, through maintaining basal levels of cytokine receptors, RNF41 is involved in the control of hematopoietic progenitor cell differentiation into myeloerythroid lineages (PubMed:18495327). Contributes to the maintenance of steady-state ERBB3 levels by mediating its growth factor-independent degradation. Involved in the degradation of the inhibitor of apoptosis BIRC6 and thus is an important regulator of cell death by promoting apoptosis. Acts also as a PRKN modifier that accelerates its degradation, resulting in a reduction of PRKN activity, influencing the balance of intracellular redox state. The RNF41-PRKN pathway regulates autophagosome-lysosome fusion during late mitophagy. Mitophagy is a selective form of autophagy necessary for mitochondrial quality control (PubMed:24949970).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an internal segment in the 3' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.