Maea (NM_021500) Mouse Untagged Clone

CAT#: MC207544

Maea (untagged) - Mouse macrophage erythroblast attacher (Maea), (10ug)


  "NM_021500" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Maea"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Maea
Synonyms 1110030D19Rik; EMP; Gid9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207544 representing NM_021500
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGTGCAGGAGTCGGCGGCCCAGCTGTCCATGACCCTGAAGGTGCAGGAGTACCCGACCCTCAAGG
TGCCCTATGAGACACTGAACAAACGCTTCCGAGCTGCTCAGAAAAACATCGATCGAGAGACTAGCCACGT
CACCATGGTGGTAGCTGAGCTTGAGAAGACCTTGAGTAGTTGCCCAGCTGTGGACTCTGTGGTCAGCCTA
TTGGATGGTGTGGTGGAGAAGCTGAGTGTCCTCAAGAGGAAGGCAGTAGAGTCCATCCAGGCCGAGGATG
AGAGCGCCAAGCTCTGCAAACGTAGGATCGAGCACCTCAAGGAGCACAGCAGTGACCAGCCAGCAGCAGC
CAGCATGTGGAAGCGGAAGCGCATGGACCGGATGATGGTGGAGCATCTGCTACGCTGTGGCTACTACAAC
ACAGCTGTGAAGCTGGCTCGCCAGAGTGGCATCGAGGACCTTGTGAATATCGAGATGTTCCTGACAGCCA
AAGAAGTGGAGGAGTCCTTGGAGAGGCGTGAGACAGCCACCTGCCTTGCCTGGTGCCATGATAACAAGTC
CCGACTCCGGAAGATGAAGAGCTGCCTAGAGTTCAGCCTCAGGATTCAGGAGTTCATTGAACTTGTCCGG
CAGAACAAGCGCCTGGATGCTGTGAGACATGCAAGAAAGCACTTCAGTCAGGCTGAAGGGAGCCAGCTGG
ATGAGGTCCGCCAGGTCATGGGCATGTTGGCCTTCCCACCAGACACACATATCTCCCCATACAAGGACCT
CCTGGACCCAGCCCGGTGGCGAATGCTGATCCAGCAGTTTCGATATGATAACTACCGGCTGCACCAGCTG
GGAAACAGCTCAGTCTTCACCCTCACCCTGCAGGCTGGGCTCTCAGCAATAAAGACACCACAGTGCTACA
AGGAGGATGGCAGCTCTAAGAGCCCTGACTGCCCTGTGTGCAGCCGCTCTCTGAACAAACTGGCACAGCC
CCTGCCCATGGCTCACTGTGCCAACTCCCGCCTGGTCTGCAAGATCTCTGGTGACGTGATGAATGAGAAT
AACCCACCCATGATGCTGCCTAATGGCTATGTCTATGGCTACAATTCTCTGCTTTCTATTCGTCAAGATG
ATAAAGTTGTTTGCCCAAGAACCAAAGAAGTCTTCCACTTCTCCCAAGCTGAGAAAGTATACATCATGTA
G


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021500
Insert Size 1191 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021500.2, NP_067475.2
RefSeq Size 2128 bp
RefSeq ORF 1191 bp
Locus ID 59003
UniProt ID Q4VC33
Cytogenetics 5 B1
Gene Summary Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. MAEA and RMND5A are both required for catalytic activity of the CTLH E3 ubiquitin-protein ligase complex. MAEA is required for normal cell proliferation. The CTLH E3 ubiquitin-protein ligase complex is not required for the degradation of enzymes involved in gluconeogenesis, such as FBP1 (By similarity). Plays a role in erythroblast enucleation during erythrocyte maturation and in the development of mature macrophages (PubMed:16707498). Mediates the attachment of erythroid cell to mature macrophages; this MAEA-mediated contact inhibits erythroid cell apoptosis (By similarity). Participates in erythroblastic island formation, which is the functional unit of definitive erythropoiesis (PubMed:16707498, PubMed:17071116). Associates with F-actin to regulate actin distribution in erythroblasts and macrophages (PubMed:16707498). May contribute to nuclear architecture and cells division events (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.