Hes6 (NM_019479) Mouse Untagged Clone

CAT#: MC207510

Hes6 (untagged) - Mouse hairy and enhancer of split 6 (Drosophila) (Hes6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hes6
• Synonyms: AI326893; bHLHb41
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207510 representing NM_019479
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTCCGTCCCAGGCGCCCAGCCGGGACCGTGCAGGCCAGGAGGATGAGGACCGCTGGGAAGCACGGG
  GGGACCGCAAGGCCCGGAAGCCCTTGGTGGAGAAGAAGCGACGCGCACGGATCAACGAGAGTCTTCAGGA
  GCTGCGGCTGCTGCTGGCCGGTACCGAGGTGCAGGCCAAGCTAGAGAACGCCGAGGTTCTGGAGCTGACC
  GTGAGGCGCGTGCAGGGCGCGCTGCGAGGCCGGGCGCGCGAGCGGGAGCAGCTGCAGGCTGAAGCAAGCG
  AGCGCTTCGCTGCTGGCTACATCCAGTGCATGCATGAGGTGCACACGTTCGTGTCCACGTGCCAAGCCAT
  CGATGCCACTGTCTCAGCTGAACTCCTGAACCACCTGCTAGAATCCATGCCACTGCGCGAGGGTAGCAGC
  TTTCAGGATCTGCTGGGGGACTCCCTAGCTGGGCTGCCTGGAGGCTCTGGGAGGAGCAGCTGGCCTCCAG
  GAGGGTCCCCAGAATCCCCATTGTCCAGTCCCCCAGGTCCCGGGGACGACCTGTGTTCTGACCTAGAGGA
  GATCCCAGAGGCTGAACTAAACCGGGTGCCTGCTGAGGGGCCGGATTTGGTGTCTACATCCTTAGGCAGC
  CTGACTGCAGCTCGCCGGGCTCAGAGTGTGTGGAGGCCTTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_019479
• Insert Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_019479.3, NP_062352.1
• RefSeq Size: 1335 bp
• RefSeq ORF: 675 bp
• Locus ID: 55927
• UniProt ID: Q9JHE6
• Cytogenetics: 1 D
• Gene Summary: Does not bind DNA itself but suppresses both HES1-mediated N box-dependent transcriptional repression and binding of HES1 to E box sequences. Also suppresses HES1-mediated inhibition of the heterodimer formed by ASCL1/MASH1 and TCF3/E47, allowing ASCL1 and TCF3 to up-regulate transcription in its presence. Promotes cell differentiation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).