Snf8 (NM_033568) Mouse Untagged Clone

CAT#: MC207474

Snf8 (untagged) - Mouse SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) (Snf8), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Snf8
• Synonyms: D11Moh34
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207474 representing NM_033568
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCACCGGCGCGGGGTGGGAGCTGGCGCCATTGCCAAGAAGAAACTCGCAGAGGCCAAGTATAAGGAGC
  GAGGGACTGTCCTGGCTGAGGACCAGCTGGCCCAGATGTCAAAACAGCTGGACATGTTCAAGACCAACCT
  AGAAGAATTTGCCAGCAAGCACAAGCAAGAGATCCGGAAGAATCCTGAGTTCCGAGTCCAGTTCCAAGAC
  ATGTGTGCAACCATTGGGGTGGATCCCCTGGCCTCTGGAAAAGGCTTTTGGTCTGAGATGCTGGGCGTTG
  GGGACTTCTATTATGAACTGGGTGTCCAGATTATTGAAGTGTGCCTGGCCCTCAAACATCGGAATGGAGG
  TCTGATAACTCTGGAGGAGCTACATCAGCAGGTGTTAAAAGGAAGGGGCAAGTTTGCTCAGGATGTCAGC
  CAAGACGACCTGATCAGGGCCATCAAGAAGCTGAAAGCCCTGGGCACTGGATTCGGCATCATCCCTGTGG
  GAGGCACTTACCTCATCCAGTCTGTTCCCGCTGAGCTCAATATGGATCACACTGTTGTGCTGCAGCTGGC
  CGAGAAAAACGGGTATGTGACTGTCAGTGAAATCAAAACCAGTCTTAAATGGGAGACGGAGCGAGCACGG
  CAAGTGCTGGAACACCTGCTGAAGGAAGGACTGGCCTGGCTGGATCTGCAGGCTCCAGGGGAGGCCCACT
  ACTGGCTGCCAGCTCTTTTCACAGATCTCTACTCCCAGGAGATATCAGCTGAGGAGGCCAAAGAAGCCTT
  CCCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_033568
• Insert Size: 777 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033568.2, NP_291046.1
• RefSeq Size: 947 bp
• RefSeq ORF: 777 bp
• Locus ID: 27681
• UniProt ID: Q9CZ28
• Cytogenetics: 11 59.24 cM
• Gene Summary: Component of the endosomal sorting complex required for transport II (ESCRT-II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs. The MVB pathway mediates delivery of transmembrane proteins into the lumen of the lysosome for degradation. The ESCRT-II complex is probably involved in the recruitment of the ESCRT-III complex. The ESCRT-II complex may also play a role in transcription regulation by participating in derepression of transcription by RNA polymerase II, possibly via its interaction with ELL. Required for degradation of both endocytosed EGF and EGFR, but not for the EGFR ligand-mediated internalization. Required for the exosomal release of SDCBP, CD63 and syndecan (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).