Zfp57 (NM_001013745) Mouse Untagged Clone

CAT#: MC207448

Zfp57 (untagged) - Mouse zinc finger protein 57 (Zfp57), transcript variant 1, (10ug)


  "NM_001013745" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfp57"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp57
Synonyms G19; Zfp-57
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207448 representing NM_001013745
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCTAGGAAACAGTCTTCCCAGCCATCCAGGACACCAGTCAGTTATGAGGACGTGGCAGTGTCTT
TCACCCAGGAAGAATGGGAATATCTTACTTCTACACAGAAGACCCTTTACCAGAAAGTGATGTCAGAAAC
CTTCAAGAACCTGACATTTGTCGGAAGCAAGAAGAAACCTCAAGAACCTAGCTCAGATCTGCAAGATAAG
AACGAGGAGCAGGAGAAGTCCTCCAGTTGCACAGGGGTATTCAAAGGTGGACCATTCTTTTTCTGTCTGA
CCTGTGGCAAATGTTTCAAAAAGAACACCTTCCTCTTTAATCACCAGTTTCCTGTGAGGTCCCGGAGGCT
GGCAGTCACAAATCCACAAAGCCGCAAAGGCAAGGGCTACAAGGCTCAGCATCGTGGAGAGAGGCCTTTC
TTTTGTAATTTCTGTGGCAAGACTTACCGTGATGCTTCTGGACTGAGCCGTCACCGACGTGCTCATTTAG
GTTATAGGCCCCGTTCATGCCCTGAGTGTGGAAAGTGTTTCCGGGATCAGTCTGAGGTCAACCGTCACCT
GAAGGTACACCAAAACAAGCCAGCAGCTAGCAACCAGGCTGGCAACCAGGCTAGCAACCAGAGGCTGAAG
AGTAGGGTTCCACCTACAACACCTAGATCCCAAGCGCCCGCCCTCAAGTATGTGAAAGTGATCCAGGGAC
CAGTGGCCAGGGCTAAGGCACGGAACAGCGGAGCCTCGACCCTGAATGTCAGATCCAACTCTATTACAGT
GGTCCGTTCAAGAGAAAAGATCTCTTGTCCCTATTGTCACATAACGTTTACCATGAGAACCTGTCTCTTA
ACCCACCTCAAGATCCACTTCAGACGTCAACCCAACCAGCACTTCTGCTGCAAAGAGTCGGCCCACTCAT
CCAACACACTCAGAATGCAAAAGATCTACACTTGCCCCGTCTGTGACAGCTCCTTTAGGGGAAAGGAGAG
CCTGCTGGATCACTTGTGCTGCCAAAGACCAATCAGATTCAGTAAATGCTGGGAAATCCTGGGTCATTTG
CTCGGCTATCTTCATGAACCCGTGGTGCTGGGAAATATTTTTAAAGTAAGGGACTCCTCGGGAAAGAGGA
TGGAATCCAGGAGGAGAAGACGGAAACGTGCCTGCACTGAGAATCCTGAAACAGAAGGCCTGTCTGGGAA
AGGTAGGGTGGCTCCGTGGGAAATGGAGGGTGCCACCAGCCCTGAGAGTCCTGTGACAGAAGAAGATTCG
GACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013745
Insert Size 1266 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC052028, AAH52028
RefSeq Size 1940 bp
RefSeq ORF 1266 bp
Locus ID 22715
UniProt ID Q8C6P8
Cytogenetics 17
Gene Summary Transcription regulator required to maintain maternal and paternal gene imprinting, a process by which gene expression is restricted in a parent of origin-specific manner by epigenetic modification of genomic DNA and chromatin, including DNA methylation. Acts by controlling DNA methylation during the earliest multicellular stages of development at multiple imprinting control regions. Required for the establishment of maternal methylation imprints at SNRPN locus. Acts as a transcriptional repressor in Schwann cells. Binds to a 5'-TGCCGC-3' consensus sequence and recognizes the methylated CpG within this element.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longer isoform (1). Variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.