Resp18 (NM_009049) Mouse Untagged Clone
CAT#: MC207377
Resp18 (untagged) - Mouse regulated endocrine-specific protein 18 (Resp18), (10ug)
"NM_009049" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Resp18 |
Synonyms | AI851012 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207377 representing NM_009049
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGAGTTCGTTAAAGCCCGCGGGCTCCGGGCATCTTCAGCTACTGGTCTGCTTCCTTCTGCTTTACA GTCGTCCAGGCAGCTGCAGCGACATAAACGCCCACGATGGTCAGGGCCAAGTGGGATCGGAACAGCTCTG GACATTCCAAGGACTTATTGCTTCAGTCTTCCAGTACTTACAACTTATATTCCACCAGATTGTACCCGAA GGCATGTTCTGGGCAGATGACATAGCCTATGAGTTAATGACCAAAAAGGTGGAGCACCTCAGCAGACTCC ACCCCCAGTATCCATGCAGGAAGGATATGAAGGCAGTTTCCCCCACGGCAAACGCTGGGGTGAGGAGCAA GCAAGAGGAGAAACTTCAACTCTTATCTCCCCAAAAGAGTCCAACAGTCAAGGTGAACAGGGACCGATGC TTTACCACCAAAGTAATCCCAAAGGCCACCAAACAAGAGGCCACCCATCCTACCAAGGGTTTCTTTGGGC CATTCCCCACTGTGGGCCTCAACCTTGTTGCTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009049 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009049.1, NP_033075.1 |
RefSeq Size | 710 bp |
RefSeq ORF | 528 bp |
Locus ID | 19711 |
UniProt ID | P47939 |
Cytogenetics | 1 C4 |
Gene Summary | This gene encodes a secreted protein that is expressed mainly in the peripheral endocrine and neuroendocrine tissues and is regulated by physiological factors that include blood glucose and dopaminergic drugs. The encoded protein is found in the lumen of the endoplasmic reticulum and is degraded in the post-ER pre-Golgi compartment. Gene knockout experiments in mice demonstrate that this gene is essential for embryonic development with embryonic lethality occurring before embryonic day 9.5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201527 | Resp18 (tGFP-tagged) - Mouse regulated endocrine-specific protein 18 (Resp18) |
USD 500.00 |
|
MR201527 | Resp18 (Myc-DDK-tagged) - Mouse regulated endocrine-specific protein 18 (Resp18) |
USD 300.00 |
|
MR201527L3 | Lenti ORF clone of Resp18 (Myc-DDK-tagged) - Mouse regulated endocrine-specific protein 18 (Resp18) |
USD 600.00 |
|
MR201527L4 | Lenti ORF clone of Resp18 (mGFP-tagged) - Mouse regulated endocrine-specific protein 18 (Resp18) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review