Mapt (NM_010838) Mouse Untagged Clone

CAT#: MC207330

Mapt (untagged) - Mouse microtubule-associated protein tau (Mapt), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mapt
• Synonyms: AI413597; AW045860; Mtapt; Tau
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207330 representing NM_010838
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGACCCTCGCCAGGAGTTTGACACAATGGAAGACCATGCTGGAGATTACACTCTGCTCCAAGACC
  AAGAAGGAGACATGGACCATGGCTTAAAAGCCGAAGAAGCAGGCATCGGAGACACCCCGAACCAGGAGGA
  CCAAGCCGCTGGGCATGTGACTCAAGCTCGTGTGGCCAGCAAAGACAGGACAGGAAATGACGAGAAGAAA
  GCCAAGGGCGCTGATGGCAAAACCGGGGCGAAGATCGCCACACCTCGGGGAGCAGCCTCTCCGGCCCAGA
  AGGGCACGTCCAACGCCACCAGGATCCCGGCCAAGACCACGCCCAGCCCTAAGACTCCTCCAGGGTCAGG
  TGAACCACCAAAATCCGGAGAACGAAGCGGCTACAGCAGCCCCGGCTCTCCCGGAACGCCTGGCAGTCGC
  TCGCGCACCCCATCCCTACCAACACCGCCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGCACTCCCC
  CTAAGTCACCATCAGCTAGTAAGAGCCGCCTGCAGACTGCCCCTGTGCCCATGCCAGACCTAAAGAATGT
  CAGGTCGAAGATTGGCTCTACTGAGAACCTGAAGCACCAGCCAGGAGGTGGCAAGGTGCAGATAATTAAT
  AAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCGAAGGATAATATCAAACACGTCCCGGGTG
  GAGGCAGTGTGCAAATAGTCTACAAGCCGGTGGACCTGAGCAAAGTGACCTCCAAGTGTGGCTCGTTAGG
  GAACATCCATCACAAGCCAGGAGGTGGCCAGGTGGAAGTAAAATCAGAGAAGCTGGACTTCAAGGACAGA
  GTCCAGTCGAAGATTGGCTCCTTGGATAATATCACCCACGTCCCTGGAGGAGGGAATAAGAAGATTGAAA
  CCCACAAGCTGACCTTCAGGGAGAATGCCAAAGCCAAGACAGACCATGGAGCAGAAATTGTGTATAAGTC
  ACCCGTGGTGTCTGGGGACACATCTCCACGGCACCTCAGCAATGTGTCTTCCACGGGCAGCATCGACATG
  GTGGACTCACCACAGCTTGCCACACTAGCCGATGAAGTGTCTGCTTCCTTGGCCAAGCAGGGTTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010838
• Insert Size: 1119 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010838.4, NP_034968.3
• RefSeq Size: 5222 bp
• RefSeq ORF: 1119 bp
• Locus ID: 17762
• UniProt ID: P10637
• Cytogenetics: 11 E1
• Gene Summary: Promotes microtubule assembly and stability, and might be involved in the establishment and maintenance of neuronal polarity. The C-terminus binds axonal microtubules while the N-terminus binds neural plasma membrane components, suggesting that tau functions as a linker protein between both. Axonal polarity is predetermined by tau localization (in the neuronal cell) in the domain of the cell body defined by the centrosome. The short isoforms allow plasticity of the cytoskeleton whereas the longer isoforms may preferentially play a role in its stabilization.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks two consecutive exons in the coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a.