Mafk (NM_010757) Mouse Untagged Clone
CAT#: MC207325
Mafk (untagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk), (10ug)
"NM_010757" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mafk |
Synonyms | AW061068; NF-E2; Nfe2u |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207325 representing NM_010757.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGACTAATCCCAAGCCCAACAAGGCATTGAAGGTCAAGAAGGAGGCGGGTGAGAACGCCCCTGTT CTTAGCGATGATGAGCTGGTGTCCATGTCAGTGCGGGAGCTAAACCAGCACCTGCGGGGGCTCACCAAG GAGGAGGTCACTCGGCTGAAGCAGCGGCGGCGCACACTCAAGAACAGAGGCTACGCGGCTAGCTGTCGC ATCAAGCGTGTGACACAGAAAGAGGAGCTGGAACGGCAGCGTGTGGAGCTACAGCAGGAGGTGGAGAAG CTGGCTCGAGAGAACAGCAGCATGCGGCTGGAGCTAGATGCCCTGCGCTCCAAGTATGAGGCCCTACAG ACCTTCGCTCGCACCGTGGCCCGAGGGCCTGTCACACCCACCAAGGTGGCCACCACCAGTGTCATCACC ATCGTCAAATCTGCCGAGCTCTCCTCCACCTCTGTACCCTTCTCAGCCGCCTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_010757 |
Insert Size | 471 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010757.2 |
RefSeq Size | 2825 bp |
RefSeq ORF | 471 bp |
Locus ID | 17135 |
UniProt ID | Q61827 |
Cytogenetics | 5 78.81 cM |
MW | 17.5 kDa |
Gene Summary | Since they lack a putative transactivation domain, the small Mafs behave as transcriptional repressors when they dimerize among themselves. However, they seem to serve as transcriptional activators by dimerizing with other (usually larger) basic-zipper proteins, such as NFE2, NFE2L1/NRF1, NFE2L2/NRF2 and NFE2L3/NRF3, and recruiting them to specific DNA-binding sites. Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NF-E2 transcription factor.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201177 | Mafk (tGFP-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 350.00 |
|
MR201177 | Mafk (Myc-DDK-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 150.00 |
|
MR201177L1 | Lenti ORF clone of Mafk (Myc-DDK-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 450.00 |
|
MR201177L2 | Lenti ORF clone of Mafk (mGFP-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 450.00 |
|
MR201177L3 | Lenti ORF clone of Mafk (Myc-DDK-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 450.00 |
|
MR201177L4 | Lenti ORF clone of Mafk (mGFP-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) (Mafk) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review