Smad3 (NM_016769) Mouse Untagged Clone

CAT#: MC207323

Smad3 (untagged) - Mouse MAD homolog 3 (Drosophila) (Smad3), (10ug)


  "NM_016769" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Smad3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Smad3
Synonyms AU022421; Madh3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207323 representing NM_016769
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTCCATCCTGCCCTTCACCCCCCCGATCGTGAAGCGCCTGCTGGGTTGGAAGAAGGGCGAGCAGA
ACGGGCAGGAGGAGAAGTGGTGCGAGAAGGCGGTCAAGAGCTTGGTGAAGAAGCTCAAGAAGACGGGGCA
GTTGGACGAGCTGGAGAAGGCCATCACCACGCAGAACGTGAACACCAAGTGCATTACCATCCCCAGGTCA
CTGGATGGTCGGCTGCAGGTGTCCCATCGGAAGGGGCTCCCTCACGTTATCTACTGCCGCCTGTGGCGAT
GGCCCGACCTGCACAGCCACCATGAATTACGGGCCATGGAGCTCTGTGAGTTTGCCTTCAACATGAAGAA
GGATGAAGTGTGTGTAAATCCTTACCACTATCAGAGAGTAGAGACGCCAGTTCTACCTCCAGTGTTGGTG
CCACGCCACACCGAGATCCCGGCCGAGTTCCCCCCACTGGATGACTACAGCCATTCCATTCCCGAGAACA
CTAACTTCCCTGCTGGCATTGAGCCCCAGAGCAATATTCCAGAAACCCCACCTCCTGGCTACCTGAGTGA
AGATGGAGAAACCAGTGACCACCAGATGAACCACAGCATGGACGCAGGTTCTCCAAACCTCTCCCCGAAT
CCGATGTCCCCAGCACACAATAACTTGGACCTACAGCCAGTCACCTACTGTGAGCCGGCCTTCTGGTGCT
CCATCTCCTACTACGAGCTGAACCAGCGAGTTGGGGAGACATTCCACGCCTCACAGCCATCCATGACAGT
AGATGGCTTCACTGACCCCTCCAACTCGGAGCGCTTCTGCCTGGGCCTACTGTCCAATGTCAACCGGAAT
GCAGCCGTGGAACTTACAAGGCGACACATTGGGAGAGGTGTGCGGCTCTACTACATCGGAGGGGAGGTCT
TTGCGGAGTGCCTCAGTGACAGTGCTATTTTCGTCCAGTCTCCCAACTGCAACCAGCGCTATGGCTGGCA
CCCGGCCACTGTCTGCAAGATCCCACCAGGCTGCAACCTGAAGATCTTCAACAACCAGGAATTTGCTGCC
CTCCTAGCTCAGTCTGTCAACCAGGGCTTTGAGGCTGTCTACCAGCTGACGCGCATGTGCACCATCCGTA
TGAGCTTCGTCAAAGGCTGGGGAGCAGAGTACAGGAGACAGACAGTGACCAGCACCCCCTGCTGGATTGA
GCTACACCTGAATGGACCCTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGTTCCCCGAGCATCCGC
TGTTCCAGTGTGTCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_016769
Insert Size 1278 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC066850, AAH66850
RefSeq Size 5090 bp
RefSeq ORF 1278 bp
Locus ID 17127
UniProt ID Q8BUN5
Cytogenetics 9 C
Gene Summary Receptor-regulated SMAD (R-SMAD) that is an intracellular signal transducer and transcriptional modulator activated by TGF-beta (transforming growth factor) and activin type 1 receptor kinases. Binds the TRE element in the promoter region of many genes that are regulated by TGF-beta and, on formation of the SMAD3/SMAD4 complex, activates transcription. Also can form a SMAD3/SMAD4/JUN/FOS complex at the AP-1/SMAD site to regulate TGF-beta-mediated transcription. Has an inhibitory effect on wound healing probably by modulating both growth and migration of primary keratinocytes and by altering the TGF-mediated chemotaxis of monocytes. This effect on wound healing appears to be hormone-sensitive. Regulator of chondrogenesis and osteogenesis and inhibits early healing of bone fractures. Positively regulates PDPK1 kinase activity by stimulating its dissociation from the 14-3-3 protein YWHAQ which acts as a negative regulator (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.