Cdk4 (NM_009870) Mouse Untagged Clone

CAT#: MC207247

Cdk4 (untagged) - Mouse cyclin-dependent kinase 4 (Cdk4), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cdk4 (NM_009870) Mouse Untagged Clone
Symbol Cdk4
Synonyms Crk3
Vector pCMV6-Entry
Sequence Data
>MC207247 representing NM_009870
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCACTCGATATGAACCCGTGGCTGAAATTGGTGTCGGTGCCTATGGGACGGTGTACAAAGCCC
GAGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTTCCTAATGGAGGAGCAGCTGGAGG
GGGCCTTCCCGTCAGCACAGTTCGTGAGGTGGCCTTGTTAAGGAGGCTGGAGGCCTTTGAACATCCCAAT
GTTGTACGGCTGATGGATGTCTGTGCTACTTCCCGAACTGATCGGGACATCAAGGTCACCCTAGTGTTTG
AGCATATAGACCAGGACCTGAGGACATACCTGGACAAAGCACCTCCACCGGGCCTGCCGGTTGAGACCAT
TAAGGATCTAATGCGTCAGTTTCTAAGCGGCCTGGATTTTCTTCATGCAAACTGCATTGTTCACCGGGAC
CTGAAGCCAGAGAACATTCTAGTGACAAGTAATGGGACCGTCAAGCTGGCTGACTTTGGCCTAGCTAGAA
TCTACAGCTACCAGATGGCCCTCACGCCTGTGGTGGTTACGCTCTGGTACCGAGCTCCTGAAGTTCTTCT
GCAGTCTACATACGCAACACCCGTGGACATGTGGAGCGTTGGCTGTATCTTTGCAGAGATGTTCCGTCGG
AAGCCTCTCTTCTGTGGAAACTCTGAAGCCGACCAGTTGGGGAAAATCTTTGATCTCATTGGATTGCCTC
CAGAAGACGACTGGCCTCGAGAGGTATCTCTACCTCGAGGAGCCTTTGCCCCCAGAGGGCCTCGGCCAGT
GCAGTCAGTGGTGCCAGAGATGGAGGAGTCTGGAGCGCAGCTGCTACTGGAAATGCTGACCTTTAACCCA
CATAAGCGAATCTCTGCCTTCCGAGCCCTGCAGCACTCCTACCTGCACAAGGAGGAAAGCGACGCAGAGT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009870
ORF Size 912 bp
Insert Size 912
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009870.3, NP_034000
RefSeq Size 1365
RefSeq ORF 912
Locus ID 12567
Cytogenetics 10|10 D3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.