Actg1 (NM_009609) Mouse Untagged Clone

CAT#: MC207218

Actg1 (untagged) - Mouse actin, gamma, cytoplasmic 1 (Actg1), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Actg1 (NM_009609) Mouse Untagged Clone
Symbol Actg1
Synonyms Actg; Actl; AL023024; E51
Vector pCMV6-Entry
Sequence Data
>MC207218 representing NM_009609
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGAAGAAATCGCCGCACTCGTCATTGACAATGGCTCCGGCATGTGCAAAGCCGGCTTTGCTGGCG
ACGACGCCCCCAGGGCCGTGTTCCCTTCCATCGTAGGGCGCCCCCGACACCAGGGCGTCATGGTGGGCAT
GGGCCAGAAAGACTCATACGTGGGTGACGAGGCCCAGAGCAAGAGGGGTATCCTGACCCTGAAGTACCCT
ATCGAACACGGCATTGTCACTAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGC
TGCGTGTGGCTCCTGAGGAGCACCCGGTGCTTCTGACCGAGGCCCCCCTGAACCCCAAAGCTAACAGAGA
GAAGATGACGCAGATAATGTTTGAAACCTTCAATACCCCAGCCATGTACGTGGCCATTCAGGCGGTGCTG
TCCTTGTATGCATCTGGGCGCACCACTGGCATTGTCATGGACTCTGGTGACGGGGTCACACACACAGTGC
CCATCTATGAGGGCTACGCCCTTCCCCACGCCATCTTGCGTCTGGACCTGGCTGGCCGGGACCTGACAGA
CTACCTCATGAAGATCCTGACTGAACGGGGCTACAGCTTTACCACCACTGCTGAGAGGGAAATTGTTCGT
GACATAAAGGAGAAGCTGTGCTATGTTGCCCTGGATTTTGAGCAAGAAATGGCTACTGCTGCATCATCTT
CCTCCTTGGAGAAGAGTTACGAGCTGCCCGACGGGCAGGTGATCACCATTGGCAATGAGCGGTTCCGGTG
TCCGGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGTATCCATGAGACCACTTTCAAC
TCCATCATGAAGTGTGATGTGGATATCCGCAAAGACCTGTATGCCAATACAGTGCTGTCTGGTGGTACCA
CCATGTACCCAGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTAGCACCTAGCACGATGAAGAT
TAAGATCATTGCTCCCCCTGAGCGCAAGTACTCAGTCTGGATCGGTGGCTCCATTCTGGCCTCACTGTCC
ACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGATGAGTCAGGCCCCTCCATCGTCCACCGCAAAT
GCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009609
ORF Size 1128 bp
Insert Size 1128
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009609.3, NP_033739
RefSeq Size 1920
RefSeq ORF 1128
Locus ID 11465
Cytogenetics 11|11 E2
Gene Summary Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.