0610008C08Rik (BC016557) Mouse Untagged Clone
CAT#: MC207106
0610008C08Rik (untagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997), (10ug)
"BC016557" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | 0610008C08Rik |
Synonyms | 0610008C08Rik; 1110019O03Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC016557
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGATCGATGAGCTTTCACTCTACTCAGTTCCTGAGGGTCAATCTAAATATGTGGAGGAGCCAAGGA CTCAACTTGAAGAAAACATCTCACAACTCCGACATCATTGTGAGCCATATACAAGTTTCTGTCAGGAAAT ATACTCCCATACTAAACCCAAGGTGGATCACTTTGTCCAGTGGGGAGTAGACAACTATAACTATCTTCAA AATGCGCCTCCTGGATTTTTCCCAAGACTCGGTGTTATTGGTTTTGCTGGTTTTGTTGGACTCCTTTTTG CTAGAGGTTCAAAAATAAAGAAGCTGGTGTATCCTCCTTTTTTCATGGGATTAGGTGCCTCTGTCTATTA CCCACAACAAGCCATCACCATTGCCCAGATCACTGGGGAGAAGTTATATGACTGGGGATTACGAGGGTAC ATAGTTATAGAAGATTTGTGGAAGCAAAATTTTCAGAAGCCAGGAAATGTGAAGAATTCACCTGGAAATA AATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC016557 |
Insert Size | 495 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC016557, AAH16557 |
RefSeq Size | 1186 bp |
RefSeq ORF | 494 bp |
Locus ID | 68316 |
Cytogenetics | X C3 |
Gene Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Plays a crucial role in crista junction formation and mitochondrial function (By similarity). Can induce cardiac lipotoxicity by enhancing mitochondrial respiration and fatty acid metabolism in cardiac myoblasts (PubMed:24743151). Promotes cholesterol efflux from macrophage cells. Detected in HDL, LDL and VLDL. Secreted by a microsomal triglyceride transfer protein (MTTP)-dependent mechanism, probably as a VLDL-associated protein that is subsequently transferred to HDL (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201308 | 0610008C08Rik (tGFP-tagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997) |
USD 365.00 |
|
MR201308 | 0610008C08Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997) |
USD 165.00 |
|
MR201308L3 | Lenti ORF clone of 0610008C08Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997) |
USD 465.00 |
|
MR201308L4 | Lenti ORF clone of 0610008C08Rik (mGFP-tagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review