0610008C08Rik (BC016557) Mouse Untagged Clone

CAT#: MC207106

0610008C08Rik (untagged) - Mouse RIKEN cDNA 0610008C08 gene (cDNA clone MGC:27851 IMAGE:3489997), (10ug)


  "BC016557" in other vectors (4)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "0610008C08Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 0610008C08Rik
Synonyms 0610008C08Rik; 1110019O03Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC016557
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATCGATGAGCTTTCACTCTACTCAGTTCCTGAGGGTCAATCTAAATATGTGGAGGAGCCAAGGA
CTCAACTTGAAGAAAACATCTCACAACTCCGACATCATTGTGAGCCATATACAAGTTTCTGTCAGGAAAT
ATACTCCCATACTAAACCCAAGGTGGATCACTTTGTCCAGTGGGGAGTAGACAACTATAACTATCTTCAA
AATGCGCCTCCTGGATTTTTCCCAAGACTCGGTGTTATTGGTTTTGCTGGTTTTGTTGGACTCCTTTTTG
CTAGAGGTTCAAAAATAAAGAAGCTGGTGTATCCTCCTTTTTTCATGGGATTAGGTGCCTCTGTCTATTA
CCCACAACAAGCCATCACCATTGCCCAGATCACTGGGGAGAAGTTATATGACTGGGGATTACGAGGGTAC
ATAGTTATAGAAGATTTGTGGAAGCAAAATTTTCAGAAGCCAGGAAATGTGAAGAATTCACCTGGAAATA
AATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC016557
Insert Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016557, AAH16557
RefSeq Size 1186 bp
RefSeq ORF 494 bp
Locus ID 68316
Cytogenetics X C3
Gene Summary Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Plays a crucial role in crista junction formation and mitochondrial function (By similarity). Can induce cardiac lipotoxicity by enhancing mitochondrial respiration and fatty acid metabolism in cardiac myoblasts (PubMed:24743151). Promotes cholesterol efflux from macrophage cells. Detected in HDL, LDL and VLDL. Secreted by a microsomal triglyceride transfer protein (MTTP)-dependent mechanism, probably as a VLDL-associated protein that is subsequently transferred to HDL (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.