OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Fxyd5 (BC031112) Mouse Untagged Clone

Be the first to review this product
SKU
MC207063
Fxyd5 (untagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Fxyd5 or BC031112"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fxyd5
Synonyms RIC, EF-8
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC031112, the custom clone sequence may differ by one or more nucleotides


ATGTCACTGTCCAGTCGCCTGTGTCTCCTCACTATTGTCGCCCTGATTCTGCCCAGCAGAGGGCAGACAC
CAAAAAAGCCCACATCCATTTTTACAGCGGACCAGACTTCTGCGACTACTCGTGACAATGTCCCAGATCC
AGATCAAACCAGCCCAGGAGTCCAGACCACCCCTCTCATCTGGACCAGAGAAGCAGAAGCCACAGGAAGC
CAGACAGCAGCCCAAACCGAGACCCAGCAACTGACAAAAATGGCCACCTCGAATCCAGTGTCAGATCCAG
GGCCACATACAAGCAGCAAGAAAGGTACCCCTGCAGTCTCCAGGATCGAGCCTCTCAGCCCATCCAAAAA
CTTCATGCCTCCATCCTACATTGAACATCCACTGGATTCGAATGAGAACAACCCCTTCTACTACGATGAT
ACTACCCTCCGGAAACGGGGACTGCTGGTGGCTGCGGTGCTGTTCATCACGGGAATTATCATTCTCACTA
GTGAGAGTCGGGCATGGGCAGAAAGGGCAAGAAGGGGCTGGGGGCGGGCTGGGCTGCATGGTGACTGA
Restriction Sites SgfI-MluI |
ACCN BC031112
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC031112
RefSeq Size 2995 bp
RefSeq ORF 963 bp
Locus ID 18301
Cytogenetics 7 B1
Summary This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. provided by RefSeq, Dec 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC031112" in other vectors (4)
SKU Description Size Price
MG201722 Fxyd5 (tGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) 10 ug
$500.00
MR201722 Fxyd5 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) 10 ug
$289.00 $300.00
MR201722L3 Lenti ORF clone of Fxyd5 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) 10 ug
$600.00
MR201722L4 Lenti ORF clone of Fxyd5 (mGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 5 (cDNA clone MGC:35841 IMAGE:4977085) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products