Hmgn3 (BC005693) Mouse Untagged Clone

CAT#: MC207028

Hmgn3 (untagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594), (10ug)


  "BC005693" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Hmgn3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hmgn3
Synonyms TRIP7, HMGN3a, HMGN3b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005693
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGAGAAAGTCTCCCGAGAACACAGAGGGCAAAGATGGAACCAAGCTAACTAAGCAGGAGCCCA
CAAGACGGTCGGCCAGGTTGTCCGCGAAACCTGTTCCACCAAAACCGGAGTCTAAACCAAGAAAAACATC
AGCTAAGAAAGAACCTGGAACAAAGATTAGCAGAGGTGCTAAGGGGAAGAAGGAAGAAAAGCAGGAAGCT
GGAGAGGAAGGTACTGCACCATCTGCAAATGGTGACACTAAAGTTGAAGAGGTACTTTCCACAAACACCT
CCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC005693
Insert Size 288 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC005693, AAH05693
RefSeq Size 1419 bp
RefSeq ORF 287 bp
Locus ID 94353
Cytogenetics 9 E2
Gene Summary Binds to nucleosomes, regulating chromatin structure and consequently, chromatin-dependent processes such as transcription, DNA replication and DNA repair. Affects both insulin and glucagon levels and modulates the expression of pancreatic genes involved in insulin secretion. Regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. Regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. May play a role in ocular development and astrocyte function.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.