Vegfb (NM_001185164) Mouse Untagged Clone

SKU
MC207023
Vegfb (untagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2, (10ug)
  $330.00
4 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Vegfb
Synonyms VEGF-B; Vrf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207023 representing NM_001185164.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCCCCTGCTCCGTCGCCTGCTGCTTGTTGCACTGCTGCAGCTGGCTCGCACCCAGGCCCCTGTG
TCCCAGTTTGATGGCCCCAGCCACCAGAAGAAAGTGGTGCCATGGATAGACGTTTATGCACGTGCCACA
TGCCAGCCCAGGGAGGTGGTGGTGCCTCTGAGCATGGAACTCATGGGCAATGTGGTCAAACAACTAGTG
CCCAGCTGTGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAATGTGTGCCCACT
GGGCAACACCAAGTCCGAATGCAGATCCTCATGATCCAGTACCCGAGCAGTCAGCTGGGGGAGATGTCC
CTGGAAGAACACAGCCAATGTGAATGCAGACCAAAAAAAAAGGAGAGTGCTGTGAAGCCAGACAGCCCC
AGGATCCTCTGCCCGCCTTGCACCCAGCGCCGTCAACGCCCTGACCCCCGGACCTGCCGCTGCCGCTGC
AGACGCCGCCGCTTCCTCCATTGCCAAGGGCGGGGCTTAGAGCTCAACCCAGACACCTGTAGGTGCCGG
AAGCCGCGAAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001185164
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001185164.1
RefSeq Size 1197 bp
RefSeq ORF 567 bp
Locus ID 22340
UniProt ID P49766
Cytogenetics 19 A
MW 21.4 kDa
Summary Growth factor for endothelial cells. VEGF-B167 binds heparin and neuropilin-1 whereas the binding to neuropilin-1 of VEGF-B186 is regulated by proteolysis. VEGF-B seems to be required for normal heart function in adult but is not required for proper development of the cardiovascular system either during development or for angiogenesis in adults.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This difference results in a frameshift and an isoform (Vegf-b167) with a shorter and distinct C-terminus, compared to isoform Vegf-b186.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001185164" in other vectors (3)
SKU Description Size Price
MR201768 Vegfb (Myc-DDK-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 10 ug
$289.00 $300.00
MR201768L3 Lenti ORF clone of Vegfb (Myc-DDK-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 10 ug
$600.00
MR201768L4 Lenti ORF clone of Vegfb (mGFP-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products