D2Wsu81e (BC078441) Mouse Untagged Clone

CAT#: MC206986

D2Wsu81e (untagged) - Mouse DNA segment, Chr 2, Wayne State University 81, expressed (cDNA clone MGC:90552 IMAGE:5686308), (10ug)


  "BC078441" in other vectors (4)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "D2Wsu81e"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol D2Wsu81e
Synonyms 9930028P05; AL033358
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206986 representing BC078441.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGAAACTGGAGCGGCAGCGTGCCCAAGAGGAAGAGGCTAAACGCCAGGAAGAGGAGGAAGAGGCG
GCGGCCCAGAGGAGCAACCAAGGACGGCCTTACACTCTGAGTGTGGCCCTGCCAGGCTCCATCCTGGAC
AATGCCCAGTCACCTGAGCTCCGCACCTACCTGGCTGGCCAGATCGCCAGAGCCTGCACCATCTTCTGT
GTGGATGAGATTGTGGTGTTCGATGAGGAGGGCCAAGATACCAAGAGTGTGGAAGGAGAATTCAGGGGA
GTTGGCAAGAAAGGGCAGGCATGTGTCCAGCTGGCCCGCATCCTACAGTACCTGGAGTGTCCACAGTAC
CTGAGAAAGGCGTTCTTCCCCAAGCACCAAGATCTGCAGTTTGCAGGAATCCTCAACCCCTTGGACAGC
CCTCACCACATGCGTCAGGACGAAGAGTCTGAGTTTCGAGAAGGCGTCGTGGTGGACCGGCCCACCAAG
GCAGGCCATGGCTCTTTGGTCAACTGTGGAATGAAGAAGCTTCTCTTCAGGAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC078441
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC078441
RefSeq Size 2440 bp
RefSeq ORF 539 bp
Locus ID 227695
Cytogenetics 2 21.29 cM
MW 20.3 kDa
Gene Summary Required for association of the centrosomes with the poles of the bipolar mitotic spindle during metaphase. Also involved in chromosome alignment. May promote centrosome maturation probably by recruiting A-kinase anchor protein AKAP9 to centrosomes in early mitosis. Binds specifically to miRNA MIR145 hairpin, regulates MIR145 expression at a postranscriptional level (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.