Mthfs (BC024567) Mouse Untagged Clone

CAT#: MC206973

Mthfs (untagged) - Mouse 5, 10-methenyltetrahydrofolate synthetase (cDNA clone MGC:37660 IMAGE:5026828), (10ug)

USD 320.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mthfs (BC024567) Mouse Untagged Clone
Symbol Mthfs
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>BC024567
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGATGAAGTTGAGACGGAAGTAATCATCAAGGACATTTTCAAACAAGGCAAAATCTGCTTCATCC
CTCAGTACCAATTCCAGAGCAATCACATGGACATGGTGAGGTTAACGTCACCTGAAGAAATTGCTTTACT
TCCCAAGACATCTTGGAATATTCATCAGCCTGGTGAGGGAGATGTTCGGGAGGAGGCCTTATCCACTGGT
GGACTTGACCTCATCTTCCTTCCTGGCCTCGGGTTTGACAAAGATGGCAACCGGCTGGGGCGGGGTAAGG
GGTACTATGACACCTACCTGAAGCGCTGTGTACAGCATCAGGAAGTGAAGCCCTACACCATGGCTTTGGC
TTTTAAAGAGCAGATCTGTCCCCAGATCCCAGTGGATGAGCATGACATGAAGGTAGATGAAGTCCTTTAT
GAAGATTCCCCAGCATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC024567
ORF Size 441 bp
Insert Size 441
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC024567,
RefSeq Size 689
RefSeq ORF 441
Locus ID 107885
Cytogenetics 9|9 E3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.