Tnfsf5ip1 (BC016606) Mouse Untagged Clone
CAT#: MC206972
Tnfsf5ip1 (untagged) - Mouse tumor necrosis factor superfamily, member 5-induced protein 1 (cDNA clone MGC:27732 IMAGE:2646038), (10ug)
"BC016606" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tnfsf5ip1 |
Synonyms | 1700017I17Rik; AW545363; Clast3; Tnfsf5ip1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206972 representing BC016606.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCGTTCCCTGCGGGGAGTCGGTCCCCGACCTAACGAACTTTACACTCCTGATGCCAGCAGTATCC GTTGGAAATGTTGGCCAGCTTGCAATAGATCAGATTATTTCTACACTGAACATGTGTAAGATTGGTTAT TTCTATACTGATTGCCTGGTGCCAATGGTTGGAAACAATCCATATGCAACTGAAGAAGAAAATTCAAAT GAACTCAGTATAAATACTGAAGTGTATTCCTTACCGTCAAAGAAGCTAGTGGTGCTTCAGTTAAGGTCC ATCTTTATTAAGGTTAGTATGCTTGCTTTTTTAAGTTCATTAATGTATGGTGACAGAACACAGTCATTA GCACTAAGAATCAAGACTAATTTTATTATATTGTTTTATATACTTAGGAAAGGGCTTGATTTAATAAAG AATTTCATAATATTTCAGGTGTGTTACTATCATTTCATTTTTATACTGAAAGAAATTGTGGATTATTCA TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC016606 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC016606 |
RefSeq Size | 780 bp |
RefSeq ORF | 485 bp |
Locus ID | 107047 |
Cytogenetics | 18 E1 |
MW | 18.3 kDa |
Gene Summary | Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG1. The PSMG1-PSMG2 heterodimer binds to the PSMA5 and PSMA7 proteasome subunits, promotes assembly of the proteasome alpha subunits into the heteroheptameric alpha ring and prevents alpha ring dimerization (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201264 | Tnfsf5ip1 (tGFP-tagged) - Mouse tumor necrosis factor superfamily, member 5-induced protein 1 (cDNA clone MGC:27732 IMAGE:2646038) |
USD 350.00 |
|
MR201264 | Tnfsf5ip1 (Myc-DDK-tagged) - Mouse tumor necrosis factor superfamily, member 5-induced protein 1 (cDNA clone MGC:27732 IMAGE:2646038) |
USD 150.00 |
|
MR201264L3 | Lenti ORF clone of Tnfsf5ip1 (Myc-DDK-tagged) - Mouse tumor necrosis factor superfamily, member 5-induced protein 1 (cDNA clone MGC:27732 IMAGE:2646038) |
USD 450.00 |
|
MR201264L4 | Lenti ORF clone of Tnfsf5ip1 (mGFP-tagged) - Mouse tumor necrosis factor superfamily, member 5-induced protein 1 (cDNA clone MGC:27732 IMAGE:2646038) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review