1700028K03Rik (BC106106) Mouse Untagged Clone
CAT#: MC206962
1700028K03Rik (untagged) - Mouse RIKEN cDNA 1700028K03 gene (cDNA clone MGC:117884 IMAGE:6491480), (10ug)
"BC106106" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | 1700028K03Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206962 representing BC106106.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAATGGATGAGCGTAGAGGAAAAGAAAGAGTACAGTGGACAACCACCATTATTATCAGCTCATCT CTTAAGAGTTACGAAATTGCAACTGCCCTAGAAAATCGAAGCCACAAGGTTCGGTATTCTGATACACTG GAAAGTGGATCGATTGTATTTTCTCTGTCTGGAGTTGCATTCTTGTTGATGGATGCTAAGGAGTGTATG ACATCGGCTGAGGAAATATTTGTAACCAAAATTGAGAAGTTTATTAACATTCACCAAAATAGTTTCTTG GTTCTATTTGCTCCACTCCATGGGCCTGAAGAATGGAGTCTCATGTTCAGGATACATCAGAGGTTCTTG GGCAGTAACTTACGAATACTTCCTGTACACAACACAGTAAACGCTCTTGACCTTATGTGCACTATAGCC AAGAGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC106106 |
Insert Size | 423 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC106106 |
RefSeq Size | 3105 bp |
RefSeq ORF | 422 bp |
Locus ID | 76421 |
Cytogenetics | 5 F |
MW | 16 kDa |
Gene Summary | Plays a key role in reinforcing the integrity of the central element of the synaptonemal complex (SC) thereby stabilizing SC, ensuring progression of meiotic prophase I in male and female germ cells (PubMed:30949703). Promotes homologous recombination and crossing-over in meiotic prophase I via its association with SHOC1 (PubMed:30746471). Required for the localization of TEX11 and MSH4 to recombination intermediates (PubMed:30746471).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200896 | 1700028K03Rik (tGFP-tagged) - Mouse RIKEN cDNA 1700028K03 gene (cDNA clone MGC:117884 IMAGE:6491480) |
USD 350.00 |
|
MR200896 | 1700028K03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700028K03 gene (cDNA clone MGC:117884 IMAGE:6491480) |
USD 150.00 |
|
MR200896L3 | Lenti ORF clone of 1700028K03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700028K03 gene (cDNA clone MGC:117884 IMAGE:6491480) |
USD 450.00 |
|
MR200896L4 | Lenti ORF clone of 1700028K03Rik (mGFP-tagged) - Mouse RIKEN cDNA 1700028K03 gene (cDNA clone MGC:117884 IMAGE:6491480) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review