Tax1bp3 (BC094314) Mouse Untagged Clone
CAT#: MC206961
Tax1bp3 (untagged) - Mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 (cDNA clone MGC:106646 IMAGE:5715687), complete, (10ug)
"BC094314" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tax1bp3 |
Synonyms | TIP-1, RP23-263M10.10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206961 representing BC094314.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCTACACCCCGGGCCAGCCTGTCACCGCCGTAGTGCAAAGAGTTGAAATTCATAAGTTGCGTCAA GGTGAGAACTTAATCTTGGGCTTCAGTATTGGAGGTGGGATCGACCAGGACCCGTCTCAGAATCCCTTC TCGGAAGATAAAACAGACAAGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAAATTGCT GGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGACATGACCATGGTCACTCACGACCAG GCTCGGAAGCGGCTCACCAAGCGCTCGGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTACAA AAGGCTGTACAGCAGTCCATGCTGTCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC094314 |
Insert Size | 375 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC094314 |
RefSeq Size | 1277 bp |
RefSeq ORF | 374 bp |
Locus ID | 76281 |
Cytogenetics | 11 B4 |
MW | 13.7 kDa |
Gene Summary | May regulate a number of protein-protein interactions by competing for PDZ domain binding sites. Binds CTNNB1 and may thereby act as an inhibitor of the Wnt signaling pathway. Competes with LIN7A for KCNJ4 binding, and thereby promotes KCNJ4 internalization. May play a role in the Rho signaling pathway (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200632 | Tax1bp3 (tGFP-tagged) - Mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 (cDNA clone MGC:106646 IMAGE:5715687), complete |
USD 350.00 |
|
MR200632 | Tax1bp3 (Myc-DDK-tagged) - Mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 (cDNA clone MGC:106646 IMAGE:5715687), complete |
USD 150.00 |
|
MR200632L3 | Lenti ORF clone of Tax1bp3 (Myc-DDK-tagged) - Mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 (cDNA clone MGC:106646 IMAGE:5715687), complete |
USD 450.00 |
|
MR200632L4 | Lenti ORF clone of Tax1bp3 (mGFP-tagged) - Mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 (cDNA clone MGC:106646 IMAGE:5715687), complete |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review