Mesdc2 (BC014742) Mouse Untagged Clone

CAT#: MC206918

Mesdc2 (untagged) - Mouse mesoderm development candiate 2 (cDNA clone MGC:25959 IMAGE:4239248), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mesdc2
• Synonyms: 2210015O11Rik; AW537813; mesd; mKIAA0081; msd
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206918 representing BC014742.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGCGACTTCTGGAGCAGTGGGAGAAAGATGATGACATAGAAGAAGGAGACCTTCCAGAACACAAG
  AGACCCTCAGCACCTATCGACTTCTCAAAGCTAGACCCAGGCAAACCTGAGAGCATCTTGAAAATGACA
  AAGAAAGGGAAGACTCTGATGATGTTTGTCACCGTGTCTGGGAACCCCACCGAGAAGGAGACAGAGGAG
  ATCACCAGCCTGTGGCAGGGTAGCCTGTTCAACGCCAACTATGACGTTCAGAGGTTCATCGTGGGATCC
  GACCGCGCCATCTTCATGCTCCGGGATGGGAGCTATGCCTGGGAGATCAAGGACTTTTTGGTCAGTCAA
  GACCGGTGTGCTGAAGTCACTCTAGAGGGACAGATGTATCCTGGCAAAGGAGGAGGAAGCAAGGAGAAA
  AATAAAACAAAGCCAGAGAAGGCTAAAAAGAAGGAGGGAGATCCCAAACCACGTGCTTCCAAGGAAGAC
  AATCGAGCTGGGAGCAGAAGAGAAGACCTTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: BC014742
• Insert Size: 516 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC014742
• RefSeq Size: 1876 bp
• RefSeq ORF: 515 bp
• Locus ID: 67943
• Cytogenetics: 7 D3
• MW: 19.4 kDa
• Gene Summary: Chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). Acts as a modulator of the Wnt pathway through chaperoning the coreceptors of the canonical Wnt pathway, LRP5 and LRP6, to the plasma membrane. Essential for specification of embryonic polarity and mesoderm induction (PubMed:12581525). Plays an essential role in neuromuscular junction (NMJ) formation by promoting cell-surface expression of LRP4 (PubMed:24140340). May regulate phagocytosis of apoptotic retinal pigment epithelium (RPE) cells (PubMed:27184668).[UniProtKB/Swiss-Prot Function]