Tbn (BC057895) Mouse Untagged Clone

CAT#: MC206887

Tbn (untagged) - Mouse taube nuss (cDNA clone MGC:68125 IMAGE:5031867), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tbn
• Synonyms: AW260255; Tbn
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206887 representing BC057895.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTGACACGGCGGCCGGGCCTGGTGGCTCCGGAACGAGACCGGGAAGTAAGCAATCCACTAACCCT
  GCTGATAACTACCATCTGGCCCGGAGGAGGACCCTGCAAGTGGTTGTGAGCTCCTTGCTGACAGAGGCG
  GGATTTGAGAGTGCCGAGAAAGCGTCTGTGGAGACACTGACAGAGATGCTGCAGAGCTACATCTCAGAA
  ATCGGGAGAAGTGCTAAGTCATACTGTGAGCACACAGCCAGGACCCAGCCCACACTGTCGGACATCGTG
  GTCACATTGGTTGAAATGGGCTTCAATGTTGACACTCTACCTGCCTATGCAAAACGGTCTCAGAGGATG
  GTCATCACTGCACCTCCAGTGACCAATCAGCCAGTGACCCCCAAGGCCCTCACTGCAGGGCAGAACCGG
  CCCCACCCGCCACACATCCCCAGCCATTTTCCTGAGTTTCCGGATCCCCACACCTACATCAAAACTCCG
  ACATACCGTGAGCCAGTGTCTGACTACCAGATCCTTCGGGAGAAGGCCGCATCTCAGAGACGAGACGTG
  GAGCGAGCACTCACCCGCTTCATGGCCAAGACAGGCGAGACCCAGAGTCTTTTCAAGGATGATGTCAGC
  ACTTTTCCTTTGATCTCTGACCAGCATTTGATTAAAGCACCGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: BC057895
• Insert Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC057895
• RefSeq Size: 1618 bp
• RefSeq ORF: 665 bp
• Locus ID: 63856
• Cytogenetics: 17 C
• MW: 24.4 kDa
• Gene Summary: Transcription factor TFIID is one of the general factors required for accurate and regulated initiation by RNA polymerase II. Mediates both basal and activator-dependent transcription. Plays a role in the differentiation of preadipocyte fibroblasts to adipocytes, however does not seem to play a role in differentiation of myoblasts. Required for the integration of TAF10 in the TAF complex (By similarity). May be important for survival of cells of the inner cell mass which constitute the pluripotent cell population of the early embryo.[UniProtKB/Swiss-Prot Function]