Rab6a (NM_001163663) Mouse Untagged Clone

CAT#: MC206851

Rab6a (untagged) - Mouse RAB6, member RAS oncogene family (Rab6), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rab6a
• Synonyms: 2610028L11Rik; AA419671; Rab6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206851 representing NM_001163663.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCCGCGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGAGAGCAGAGC
  GTTGGAAAGACGTCCTTGATCACCCGATTCATGTATGACAGTTTTGACAACACCTATCAGGCAACAATT
  GGCATTGACTTCTTATCAAAAACAATGTACTTGGAGGATAGAACCATCAGGCTGCAGCTGTGGGATACT
  GCGGGTCAGGAACGTTTCCGTAGCCTCATTCCCAGTTACATCCGTGACTCTGCTGCAGCCGTAGTAGTT
  TACGATATCACAAATGTTAACTCATTCCAGCAAACTACAAAATGGATTGATGATGTCAGAACAGAGAGA
  GGAAGTGATGTCATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGATAAGAGGCAAGTGTCAATT
  GAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACCAGTGCAAAAGCAGGATAC
  AATGTAAAGCAGCTTTTCCGGCGTGTTGCTGCAGCTTTACCTGGAATGGAAAGCACACAGGACAGAAGC
  AGAGAAGACATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAATGAAGGCGGCTGTTCC
  TGCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163663
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001163663.1
• RefSeq Size: 3243 bp
• RefSeq ORF: 627 bp
• Locus ID: 19346
• UniProt ID: P35279
• Cytogenetics: 7 E2
• MW: 23.5 kDa
• Gene Summary: Protein transport. Regulator of membrane traffic from the Golgi apparatus towards the endoplasmic reticulum (ER). Involved in COPI-independent retrograde transport from the Golgi to the ER (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: Variants 1 and 2 include either one of two duplicated, alternatively spliced coding exons and are the same length. The resulting proteins (isoforms 1 and 2, respectively) are the same length but differ at three amino acid positions. This variant (1) encodes isoform 1.