Cd8a (BC030679) Mouse Untagged Clone

CAT#: MC206824

Cd8a (untagged) - Mouse CD8 antigen, alpha chain (cDNA clone MGC:41580 IMAGE:1247019), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cd8a
• Synonyms: BB154331; Ly-2; Ly-35; Ly-B; Lyt-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206824 representing BC030679.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACGCCGAACTTGGTCAGAAGGTGGACCTGGTATGTGAAGTGTTGGGGTCCGTTTCGCAAGGATGC
  TCTTGGCTCTTCCAGAACTCCAGCTCCAAACTCCCCCAGCCCACCTTCGTTGTCTATATGGCTTCATCC
  CACAACAAGATAACGTGGGACGAGAAGCTGAATTCGTCGAAACTGTTTTCTGCCATGAGGGACACGAAT
  AATAAGTACGTTCTCACCCTGAACAAGTTCAGCAAGGAAAACGAAGGCTACTATTTCTGCTCAGTCATC
  AGCAACTCGGTGATGTACTTCAGTTCTGTCGTGCCAGTCCTTCAGAAAGTGAACTCTACTACTACCAAG
  CCAGTGCTGCGAACTCCCTCACCTGTGCACCCTACCGGGACATCTCAGCCCCAGAGACCAGAAGATTGT
  CGGCCCCGTGGCTCAGTGAAGGGGACCGGATTGGACTTCGCCTGTGATATTTACATCTGGGCACCCTTG
  GCCGGAATCTGCGTGGCCCTTCTGCTGTCCTTGATCATCACTCTCATCTGCTACCACAGGAGCCGAAAG
  CGTGTTTGCAAATGTCCCAGGCCGCTAGTCAGACAGGAAGGCAAGCCCAGACCTTCAGAGAAAATTGTG
  TAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: BC030679
• Insert Size: 624 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC030679
• RefSeq Size: 1452 bp
• RefSeq ORF: 623 bp
• Locus ID: 12525
• Cytogenetics: 6 32.14 cM
• MW: 23.1 kDa
• Gene Summary: Integral membrane glycoprotein that plays an essential role in the immune response and serves multiple functions in responses against both external and internal offenses. In T-cells, functions primarily as a coreceptor for MHC class I molecule:peptide complex. The antigens presented by class I peptides are derived from cytosolic proteins while class II derived from extracellular proteins. Interacts simultaneously with the T-cell receptor (TCR) and the MHC class I proteins presented by antigen presenting cells (APCs). In turn, recruits the Src kinase LCK to the vicinity of the TCR-CD3 complex. LCK then initiates different intracellular signaling pathways by phosphorylating various substrates ultimately leading to lymphokine production, motility, adhesion and activation of cytotoxic T-lymphocytes (CTLs). This mechanism enables CTLs to recognize and eliminate infected cells and tumor cells. In NK-cells, the presence of CD8A homodimers at the cell surface provides a survival mechanism allowing conjugation and lysis of multiple target cells. CD8A homodimer molecules also promote the survival and differentiation of activated lymphocytes into memory CD8 T-cells.[UniProtKB/Swiss-Prot Function]