Eif4b (BC007171) Mouse Untagged Clone

CAT#: MC206803

Eif4b (untagged) - Mouse eukaryotic translation initiation factor 4B (cDNA clone MGC:7530 IMAGE:3492114), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Eif4b (BC007171) Mouse Untagged Clone
Symbol Eif4b
Synonyms Eif4a2
Vector pCMV6-Kan/Neo
Sequence Data
>BC007171
GAATAAGAAGGGGAAGACCATCTCCCTAACAGACTTTCTAGCTGAGGATGGAGGACCTGGTGGAGGAAGC ACCTATGTCCCCAAACCAGTCAGCTGGGCTGATGAAACAGACGATCTGGAAGGAGATGTGTCAACAACTT GGCATAGTAACGATGATGACGTGTACAGGGCGCCTCCAATTGACCGTTCCATCCTTCCCACTGCTCCACG GGCTGCTCGGGAACCCAATATTGACCGGAGCCGTCTTCCCAAGTCGCCACCCTACACTGCTTTCCTAGGG AATCTGCCCTATGATGTGACAGAAGACTCCATTAAGGATTTCTTTAGAGGATTAAATATCAGCGCTGTAC GCTTACCACGGGAACCCAGCAATCCAGACAGGTTGAAAGGTTTCGGCTACGCAGAATTTGAGGACCTGGA TTCTCTGCTCAGTGCTCTGAGTCTCAATGAAGAGTCTCTAGGTAACAGGAGAATTCGTGTGGATGTTGCT GATCAAGCACAGGATAAAGACAGGGATGACCGTTCTTTTGGTCGAGATAGAAATCGGGATTCTGACAAAA CAGACACAGACTGGAGGGCCCGTCCCACCACAGACAGTTTTGATGACTACCCACCTAGAAGAGGCGATGA TAGCTTTGGAGACAAGTATCGAGATCGTTACGATTCAGACCGGTATCGGGATGGGTATAGGGACGGATAT CGGGACGGCCCACGCAGAGACATGGACCGCTATGGGGGCCGGGATCGCTATGATGACCGAGGCAGCAGAG ACTATGACCGAGGCTATGACTCCAGGATAGGCAGTGGCAGAAGAGCATTTGGAAGTGGGTACCGGAGAGA TGATGACTACAGAGGAGGTGGGGACCGCTATGAAGACCGCTATGACAGACGGGATGATCGGTCGTGGAGC TCCAGGGATGACTACTCTCGGGATGATTATAGGCGTGATGACAGAGGTCCCCCCCAGAGACCCAGACTGA ACCTCAAGCCTCGCAGCGCTCCTAAGGAGGATGACGCCTCCGCCAGCACCTCCCAGTCCAGCCGGGCAGC CTCCATCTTTGGAGGGGCGAAGCCTGTTGACACAGCTGCTAGGGAAAGAGAAGTAGAGGAGCGGCTACAG AAGGAGCAGGAGAAGCTGCAGCGTCAGCTGGATGAGCCAAAACTAGACCGCCGGCCCCGGGAGAGACACC CAAGCTGGCGAAGTGAAGAAACTCAGGAAAGAGAACGGTCAAGGACAGGAAGTGAGTCATCGCAGACTGG GGCCTCAGCCACATCTGGCAGAAATACACGAAGGAGAGAGAGTGAGAAGTCTCTAGAAAATGAAACCCTC AATAAAGAAGAAGACTGTCACTCTCCAACCTCTAAGCCTCCTAAACCTGACCAGCCTCTAAAGGTAATGC CAGCCCCTCCACCAAAGGAGAATGCGTGGGTGAAGCGAAGCTCTAACCCTCCTGCCCGATCTCAGAGCTC AGACACAGAGCAGCCGTCCCCTACAAGTGGTGGAGGGAAAGTAGCTGCAGTCCAGCCCCCTGAGGAAGGA CCATCAAGAAAAGATGGAAATAAAGTGGATGTGGTGGGTGCCACACAAGGCCAAGCTGGAAGCTGCAGCC GTGGTCCCGGGGATGGAGGGAGCAGAGACCACTGGAAGGACTTGGATAGGAAGGATGGCAAAAAAGATCA AGATTCCAGATCTGCACCTGAGCCAAAGAAACCTGAGGAGAACCCAGCCTCCAAGTTCAGCTCTGCAAGC AAGTACGCTGCTCTGTCTGTGGATGGCGAGGATGAGGATGAGGGCGACGACTGCACTGAGTAGGACCTCC GCACCCTGTGCTTTCTCCTAGTCTCCACCCCGGAACATTCAAGAGCAAATCAAACCTCTATCCAGACAAG ACAAAATAAACTCACCATCTCCTGAAGACCTTTCTAAACTTTTTTTTTTAATGAAATGAAATTCTTTTGC ATGCTGCTGCAGCCTTTTAAAGTATTGAAGTAACTGGAGAATCACCATTGTAGCCAGAGACGTGGCTACC GCTTTTGAATGGGGAAGTTGTGTCTGACAATACCAAGCAGTTACTGTGTGACTAGTGCCTGGGGCTCCAT TCAGCAGAATTGCAGTGACAGAGAGGCAGTCACATCAGTTAGGCAGTAGAAAAAGGTGCAAAGCAGAAGT GAGATTTCTACCTTCTAATTCTTATCCTGAGATGGCACCTGTGAATACCCAAACATTACCTGAATAAATT TCCCATCCTTAGAAAGGTAGCTCTAGTCTCAAGCTGTTTTAGTCTCCAGGAGGCTGCCAGCCCCTCTACT TTAGTTCTGACTTCAATGGGGCCAGCCTAAGGGGGAATTGTTTTATTTTTTTACCCCCCAAGGGGGTAGT TGGGAGTGAGTCTACGGGGCACTAACAAGTAGTTCCGCTTGGGGACCAAGATGAACGGAAACTCAATCGT GGTTTGGAAAGCTTTGGGGAGGTGACTAATTATATTTTATACCCGGTAGTGAGGGAAACAGTGTGACCTC CAGTAAACACATACATAGAATGGTCATTTCTGGATGAGGAAGCACTTAACAGGTAGTGAGAAGGCCTGGC TTTGCCCCTTCTAAACTCTCCTTTCTAGAGGTTGAAATATACCCATATTTTTTTGAAAACCTTGTCACTC TGGTCATCTCATGGTCTCCATGACACTTAGCCTCCCAGAGCTGTCTGTGAGTCACACACCTCCCACAGAC ACTGTATCTTAGCCACAAAAAGCCATGGCCTGAGGACTCGCTGCTTTTCTCAAGCAAGCCAGTGAGTTTT CTCTGTGCCATCTTTGATTTCTGCCTGCTCCTGCAGCTTTCAGCCTCAACTGATGGGCTTGGGTGGTGAA TAGGGGTGTGTAAATGGGGTGAGTTGGAGGTCTTCAGCCTTGAATGGGGTGTAAGGTTTCTATAAATCTC CCTCACTGGAGCCCCACGCTGGTGCTTGTTTATAATGTATGTGACCCTGACTGGTTTTCTGCTTAGGAGG GTTGGCTTCTTTACTCCCCTCAAGAATAAAGGATAATGCAAAGAACTATTGAGCAAGGTCCTGGTTTCTC TTGCAACACTGTAGCTTGACCTGTCTGCTTTGATGTGCACCTTTGTAGGGGTCAGCTCCAAAGATGGCGA GCCTCCCTGTTGTGGGTAGTCAGGCACCTGCAGACAGACGATACCTTGGTCCTAGGCCTGCTGTGCAGGA GCATTGATGTCCCGTGCTGCAGCAGCAGGCACAGCAAATCGCTTCTCCGGTGGATTTGATTGGCTAGTAG CTAGGAAGTGGGCTTTTGCAGATACCCACAGTTGAATGGGTTTTTTTAAACCATTGTTGTAGACAATGAG AAGGTAGTTTGCCCTCTTCATGTCTATTTCCCTTCCAGATAGTTGCATCCGAAGACAGCTGTTTTGTCCC ACTCTCCTACTTTGCTCCTCTGTTAAAATAAAAACAGGGGTTGACTTATGTCCCGCTCCTGAATACATGT AAAATTTGTACAAAAATATCTTCTATGAAAATGATTTGTAATCTGTAGACATTACTTGGGAGATGTCTTG AGATGTAAAATCCCATCCTTTGGGTTGAGGGTTTTTTTGTTTTTCTCCAAATAAATCCAGTCTTTAAAGT TGAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC007171
ORF Size 1092 bp
Insert Size 1092
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC007171,
RefSeq Size 3658
RefSeq ORF 1092
Locus ID 75705
Cytogenetics 15|15 F2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.