Gpr108 (BC016104) Mouse Untagged Clone

CAT#: MC206750

Gpr108 (untagged) - Mouse G protein-coupled receptor 108 (cDNA clone MGC:27688 IMAGE:4920840), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpr108 (BC016104) Mouse Untagged Clone
Symbol Gpr108
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC016104
CAGAGATGGCAGTGAGCGAGAGGAGGGGGCTCAGCGGCGAGAGCCCAACGCAGTGCCGATGGGGATACTT GTCGCTGCTGGTGCTGACGCTGAGCGGCTGCTCAGGCCGTATCCACCGGCTGACTCTCACAGGGGAGAAG CGAGCTGACATCCAACTGAACAGCTTCGGATTCTACACCAATGGTTCCCTGGAAGTAGAGCTGAGCTTAC TGCGACTCAGCCTCCAGGAGACAGAAAAGAAGTTGCCAAAGGTGGGGTTCAGCTTGAGCAGAGTTCGGTC TGGCAGTGTCCGCTCCTACTCGAGACGGAACTCCCATGAATGCCCTCTGGATAGAAACAGCAGCAACTTC CTGGTCCTGTTCCTCATCAATATCAAGGACCTGCAGGTCCAAGTCCGAAAATATGGGGAGCAGAAGTTGT TCATCTCCCCTGGCCTTCTCCCTGAAGCTCCCACCCAGTCAGGTCCCCCGAAACCAGACCCAGCAGGCAC CCCCAAGGACAACCACGTCATTCACCCATCTCCTACAGAGATGTCTGCAGTCAAGGAGAATCAGACAGCG CCCCAGGTTTCAGGGGATAAAACTACCCCAGGGGAACACAGGCACTCATCCGAGAGACAGCCACCCACGC AGGACCCCAGTGGGAAGGAGAAGGATCAGGTGTTGGGACTGGGCCACCTCAATGACTCCTACAACTTCAG TTTCCACATTGTGATCAGCTCCAGGGCTGAGGAAGGCCAGTACAGCCTCAACTTCCACAACTGTCACAAC TCCATCCCAGGCCAGGAGCAGCCATTCGACCTCACTGTGATGATCCGGGAGAAGAATCCAGAAGGCTTCT TGTCAGCAGCCGAAATCCCCCTCTTCAAACTCTACCTGATCATGTCTGCCTGCTTTCTGGCCGCAGACAT CTTCTGGGTGTCCGTGCTCTGCAAGAACACATACAGTGTCTTCAAGATCCACTGGCTCATGGCAGCCCTG GCGTTCACCAAGAGTGTCTCCCTACTCTTCCACAGCATCAACTACTACTTCATCAACAGCCAGGGCCACC CCATCGAAGGCCTCGCGGTCATGCACTATATCACACACCTGCTGAAGGGCGCCCTTCTCTTCATCACCAT CGCCTTGATCGGCTCAGGCTGGGCCTTTGTGAAGTATATGCTGTCGGACAAGGAGAAGAAGATTTTTGGC ATTGTGATTCCCCTGCAGGTCCTGGCTAATGTAGCATACATTGTCATTGAGTCCCGTGAGGAGGGTGCCA GCGACTATGGACTCTGGAAGGAGATCTTGTTCCTGGTGGATCTCATCTGCTGTGGTGCCATCCTTTTCCC GGTGGTCTGGTCCATTCGGCATCTGCAGGATGCATCCGGCACTGATGGGAAGGTGGCAGTGAACCTGGCC AGGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATATCTACTTTACACGTATCATCGCCA TTCTGCTGCAAGTAGCAGTGCCCTTCCAGTGGCAGTGGCTGTACCAGCTCTTGGTGGAGAGTTCCACACT GGCCTTCTTCGTGCTCACTGGCTACAAGTTCCAGCCGGCTGGGGACAACCCATACCTGCAGCTGCCACAG GAGGATGAGGAGGACGTACAGATGGAGCAAGTGATGACAGACTCTGGGTTTCGGGAAGGCCTGTCCAAAG TTAACAAGACAGCCAGTGGCCGGGAGCTGTTGTGACTTCCCTGTGTCCAGTGAGCCGCCCTCAGACCTCC TGCACCTCGCACCCCTACACTTGTCCCAAGTGTGCAGGGAGCTGGAGGGGATGCTGCGGACAAGGCATCC AGGATGTGGATCCCCAAGGAGCCTTCAGAAAAGATGCCCTCTCCTCACCAGGGAGCAAGCAGTTCAGCCT CTTGTGGTACAATAAGGACCAGTCTCTTGACTTGGAGGGTTCTGAGTATCTACGGCAGGCTGCATTTATG ATCTCAGTTCACGGGGTGGCACGTGCCTGTCATCCCATTGCTCTGGAGAGCCCGGGCTTCATAAAACCTT GATTAGTAAACAAATAAAGAAAAAGTGGAATTCCCAGTGAGGGGAGGACCACCTGTTGAGCTAAAAAAAA AAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC016104
ORF Size 1710 bp
Insert Size 1710
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC016104,
RefSeq Size 2115
RefSeq ORF 1710
Locus ID 78308
Cytogenetics 17|17 D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.