Ap2b1 (BC046772) Mouse Untagged Clone

CAT#: MC206684

Ap2b1 (untagged) - Mouse adaptor-related protein complex 2, beta 1 subunit (cDNA clone MGC:61224 IMAGE:5708062), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ap2b1 (BC046772) Mouse Untagged Clone
Symbol Ap2b1
Vector pCMV6-Kan/Neo
Sequence Data
>BC046772
CGCAGTGGCTTAGATCTAGAGAGAATCGTGACGGGCAGGAAACCATTACACCACCACCCCGGCTGTGCTC TCCGACTGCCGCCGCCGCCGCCGCCACCCCGCCCTTGCCTCCGGTTCACGCTAAAGATCCAGAATCATGA CTGACTCCAAGTACTTCACAACCAATAAGAAGGGAGAAATTTTTGAATTAAAAGCTGAACTCAACAATGA AAAGAAAGAAAAGAGGAAGGAGGCTGTGAAGAAAGTGATTGCTGCTATGACCGTGGGGAAGGACGTGAGC TCTCTCTTCCCAGATGTGGTGAACTGCATGCAGACTGACAACCTGGAACTAAAGAAGCTCGTGTACCTCT ATCTGATGAACTATGCCAAGAGTCAGCCAGACATGGCCATCATGGCTGTCAACAGCTTTGTGAAGGATTG TGAAGATCCCAATCCTTTGATTCGAGCCTTGGCAGTTAGAACCATGGGATGCATCCGGGTGGACAAGATT ACAGAGTATCTCTGTGAACCCCTCCGCAAGTGCTTGAAGGATGAAGACCCCTATGTTCGGAAAACGGCAG CAGTATGCGTGGCAAAACTCCATGATATCAATGCCCAGATGGTGGAAGATCAGGGATTTCTGGATTCTCT GCGGGATCTCATAGCAGATTCAAACCCAATGGTGGTGGCTAATGCTGTAGCAGCATTGTCTGAGATCAGT GAGTCTCACCCAAACAGCAACTTACTTGATCTGAACCCTCAGAATATCAATAAGCTGCTCACAGCCCTGA ATGAATGCACTGAATGGGGCCAGATTTTCATCCTGGACTGCCTGTCTAATTACAACCCTAAAGATGACCG GGAAGCTCAGAGCATCTGTGAGCGAGTAACGCCTCGGCTCTCCCACGCCAACTCTGCAGTGGTGCTTTCA GCCGTAAAAGTCCTAATGAAGTTTCTAGAATTGTTGCCCAAGGACTCTGACTACTACAATATGCTGCTAA AGAAGTTAGCACCTCCACTTGTCACGTTGCTGTCTGGGGAGCCAGAAGTACAGTACGTCGCCCTGAGGAA CATCAACCTAATTGTCCAGAAAAGGCCTGAAATCTTGAAGCAGGAAATCAAGGTCTTCTTTGTGAAGTAC AATGATCCTATCTATGTTAAACTAGAGAAGTTAGACATCATGATTCGTCTTGCATCCCAAGCCAACATTG CTCAGGTTCTGGCGGAGCTGAAGGAATATGCCACTGAAGTTGATGTGGACTTTGTTCGCAAAGCTGTGAG GGCCATTGGACGGTGTGCCATCAAAGTGGAGCAATCAGCAGAACGCTGTGTAAGCACACTGCTTGATCTA ATCCAGACCAAAGTAAATTATGTGGTCCAAGAGGCAATTGTTGTCATCAGGGACATCTTCCGAAAATACC CCAACAAGTATGAAAGTATTATTGCCACCCTCTGTGAAAACTTGGACTCCCTGGATGAACCCGATGCCCG AGCAGCTATGATTTGGATTGTAGGAGAATATGCTGAAAGAATCGATAACGCAGATGAATTACTAGAGAGT TTCCTGGAAGGTTTTCATGACGAAAGCACCCAGGTGCAGCTCACACTGCTCACCGCCATAGTGAAGCTGT TTCTCAAGAAGCCATCAGAAACACAGGAGCTGGTCCAACAGGTCTTGAGCTTAGCCACACAGGACTCCGA TAACCCTGACCTTCGAGATCGGGGTTATATATATTGGCGCCTTCTTTCAACTGACCCTGTGACAGCCAAA GAAGTGGTGTTGTCTGAGAAGCCATTGATCTCTGAGGAGACAGACCTCATTGAGCCTACCCTCCTGGATG AGCTCATCTGCCACATTGGTTCTTTGGCCTCTGTGTACCACAAACCTCCAAATGCTTTTGTGGAAGGGAG TCATGGGATTCATCGCAAACACTTGCCAATTCATCATGGGAGCACTGATGCAGGTGATAGCCCCGTTGGC ACCACCACTACAACCAACCTGGAGCAGCCTCAGGTCATTCCCTCTCAAGGTGACCTTCTGGGGGATCTTT TGAATCTTGACCTGGGTCCCCCAGTGAATGTCCCGCAAGTGTCCTCCATGCAGATGGGAGCGGTGGATCT TTTAGGAGGAGGACTGGATAGCCTGCTTGGCAGTGACCTTGGCGGGGGCATTGGAGGAAGTCCGGCAGTA GGACAGTCCTTCATCCCGTCATCAGTGCCTGCGACCTTCGCTCCTTCACCTACTCCTGCTGTGGTCAGCA GTGGTCTGAATGACCTGTTTGAGCTTTCCACTGGGATAGGCATGGCACCTGGCGGATATGTGGCTCCTAA GGCGGTCTGGCTACCTGCAGTAAAGGCTAAAGGCTTGGAGATTTCGGGGACGTTTACTCACCGCCAAGGG CATATCTATATGGAAATGAACTTCACCAACAAAGCTCTGCAGCATATGACAGACTTTGCCATCCAGTTTA ACAAGAATAGCTTCGGTGTCATCCCAAGCACTCCCTTGGCCATACATACTCCACTGATGCCAAACCAGAG CATTGACGTCTCTCTGCCGCTCAACACCTTGGGCCCAGTCATGAAGATGGAGCCCCTGAATAACCTGCAG GTGGCTGTTAAAAACAATATTGATGTCTTCTACTTCAGCTGCCTCATCCCACTCAATGTGCTTTTTGTAG AAGATGGCAAAATGGAGCGCCAGGTCTTCCTTGCAACGTGGAAGGATATTCCCAATGAAAATGAACTCCA GTTTCAGATTAAGGAATGTCATTTAAATGCTGACACAGTTTCCAGCAAGTTGCAAAACAACAATGTTTAC ACTATTGCCAAGAGGAACGTGGAAGGGCAGGACATGCTGTACCAGTCCCTGAAGCTCACTAATGGCATTT GGATTTTGGCAGAGCTGCGGATCCAGCCAGGAAACCCCAATTATACGCTGTCGCTGAAGTGTAGAGCCCC TGAAGTCTCTCAGTACATCTATCAGGTCTACGACAGCATTTTGAAAAACTAATAAATGGGTCCAGTCAGC CTGTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
Tag Tag Free
ACCN BC046772
ORF Size 2856 bp
Insert Size 2856
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC046772,
RefSeq Size 3038
RefSeq ORF 2856
Locus ID 71770
Cytogenetics 11|11 C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.