2700094K13Rik (BC056177) Mouse Untagged Clone

SKU
MC206667
2700094K13Rik (untagged) - Mouse RIKEN cDNA 2700094K13 gene (cDNA clone MGC:67366 IMAGE:5683334), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol 2700094K13Rik
Synonyms Selh
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC056177
TTTCCCTTTGCTGCGAGATTTGAACTTTGCATCTGTGATTCCCGGCTGCTGGTTTGTCTCTCCGGAGTTG CATCGCCCCTTATTCCACCAACGCGCCATCCCCGAAATCCGTGCCATGGCCCCCCACGGAAGAAAGCGTA AGGCGGGGGCCGCGCCTATGGAGACGGTGGACAAGCGCGAGAAACTGGCGGAGGGCGCGACCGTGGTCAT TGAGCATTGTACGAGCTGACGCGTGTACGGCCGCCATGCTGCTGCCTTGAGCCAGGCTCTGCAACTGGAG GCCCCAGAGCTACCTGTGCAAGTGAACCCGTCCAAACCGCGGAGGGGCAGCTTCGAGGTGACGCTGCTGC GCTCGGACAACAGCCGTGTTGAACTCTGGACTGGTATTAAGAAGGGCCCTCCACGAAAGCTCAAATTTCC TGAGCCTCAAGAGGTGGTTGAAGAATTGAAGAAGTACCTTTCATAAAGAGGTTGGGAAAGAGTCCTCATG TTGAGCTTTCAGTCCCTGGAGATGTTGAAGCATTTATGATGGTGCATGGCCAAACTTAAGCTATGCACCT GAAGCCATAGTTTCTTCCTCACCAGAAGTGATGGTTCAGTTGTGAGGCAGCCCTCCAGCAAGACATTGTA AAAGTGTTTCAATTGTTTAATAAAAGGTCAAGTATCTGAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI |
ACCN BC056177
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC056177, AAH56177
RefSeq Size 688 bp
RefSeq ORF 351 bp
Locus ID 72657
Cytogenetics 2 D
Summary This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. provided by RefSeq, May 2016
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products